good morning, america. breaking point. in 24 hours, more than 3,000 american lives lost to covid-19. the highest number of deaths since the start of the pandemic with the cdc warning the nation to brace for up to 200,000 more deaths in the next three months calling it the most difficult time in the public health history of this nation. hospitalizations have hit an all-time high, now topping 100,000. and overnight, los angeles under the strictest emergency stay-at-home order yet due to the surge. >> it's time to cancel everything. and if it isn't essential, don't do it. hope on the horizon. "operation warp speed" revealing how they will get the first 20 million doses of vaccine to americans across the country as states decide who will get it first. the governor of maryland joins

us live with how states will roll it out and dr. jha standing by to answer your questions about the vaccine. help on the way? democratic leaders now backing a $900 billion plan hatched with moderate republicans that could deliver badly needed cash to millions of americans, the latest as time runs out to strike a deal. extreme wildfire danger. exploding in the west overnight, some of the strongest, most dangerous winds of the year fueling the flames. the latest on the new red flag warnings and the mandatory evacuations this morning. heading home. the race car driver who survived this horrific crash released from the hospital after just three days. what was going through his mind as he made that miraculous escape? shipping crunch. after that record-setting start to the holiday shopping season, u.p.s. reportedly pumping the brakes on picking up packages from some major retailers. what it could mean for getting gifts on time. ♪ all i want for christmas is you ♪ and all we want for christmas is mariah.

the queen of christmas is joining us live this morning talking about her star-studded new holiday special as we count down to christmas this morning. ♪ all i want for christmas is you ♪ we're re-creating "love actually" and you, and you. good morning, america. we are thankful to have mariah carey with us on this thankful thursday. she's going to bring us some holiday cheer. >> she always does, and that song once again climbing the charts 26 years after it was first released. >> we are looking forward to seeing her. but we begin with that stark new warning. the director of the cdc now says we're on the brink of the most difficult part of it and hospitalizations have hit record highs around the nation and we're coping now with a staggering new number of american lives lost in a single day, more than 3,100 people.

>> whit johnson joins us now from a testing center in norwalk, connecticut. good morning, whit. >> reporter: michael, good morning to you. as cases surge across the country, the cdc is calling on communities to expand testing to people without symptoms. it's something the agency has gone back and forth on but local leaders have been pushing for this and seen this rush on testing during the holiday season. from above and our drone camera overlooking this drive-through testing site in norwalk, connecticut, where cars have been lined up for hours before the gates even opened. this morning, the u.s. hitting its deadliest single day of the pandemic. more than 3,100 lives lost in just 24 hours. and the cdc now predicting up to 200,000 more americans could die in the next three months. a staggering toll that would approach nearly 500,000 by february. >> december and january and february are going to be rough times. i actually believe they're going to be the most difficult time in the public health history of

this nation. >> reporter: the white house coronavirus task force issuing its most urgent warning yet to the states, everyone over the age of 65 or with significant health conditions should not enter any indoor public areas where anyone is unmasked. also pleading with those under the age of 40 to assume they are infected if thanksgiving involved anyone outside immediate family. writing, you are dangerous to others and you must isolate away from anyone at increased risk for severe disease and get tested immediately. >> that's real stuff. that's not fake and that's the reason why we give these kinds of warnings of what people need to do. >> reporter: in los angeles, mayor eric garcetti urging residents to stay home. >> my message couldn't be simpler. it's time to hunker down. it's time to cancel everything, and if it isn't essential, don't do it. >> reporter: this as the u.s. hits another milestone, more than 100,000 people now hospitalized with covid. a new record and more than

double the number reported on november 1st. >> we're very concerned at the number of cases that were present today. i don't even think that that represents thanksgiving holiday. >> reporter: icus near capacity in new mexico, north dakota and rhode island. the cdc director revealing that 90% of the nation's hospitals are in a red zone. >> the report that i received is we had negative 31 beds. that means we had 31 admitted patients who did not have a bed to go to. >> reporter: in michigan, doctors performing an emergency c-section on covid patient jazmine logan delivering healthy twins before putting jazmine on a ventilator. >> i'm picking my kids up and i can't even see my wife. this is something that we're supposed to be doing together. >> reporter: such a difficult time for so many families across the country. the cdc is now renewing its travel warning advising people to stay home and not travel at all. avoid gatherings with anybody outside your own household.

and that's for the remainder of the holiday season. robin? >> as you said, a very difficult time for many. whit, thank you. the rollout of the vaccine will be a massive effort as we know and the stakes could not be higher. alex perez is at a pfizer facility in kalamazoo, michigan, with the latest on how "operation warp speed" expects to distribute the vaccine across the country. good morning, alex. >> reporter: hey, good morning, robin. there are already millions of doses of the vaccine here at the pfizer campus behind me standing by ready to be shipped the moment they get the green light which could be in just a matter of days. this morning, government officials expecting emergency authorization of the covid-19 vaccines to come within the next few weeks. >> that means we can make our first shipments of vaccine to states this month, and we are on track to be able to ship enough vaccine for 20 million americans before the end of the year. >> reporter: on wednesday, "operation warp speed" revealing how it will be dividing and distributing the nearly 20 million doses across the country

by the end of the month saying they will be shipped in two portions because it's a two-dose vaccine. >> half of the allocation will be sent out and then 21 days later for pfizer and 28 days later for moderna, we send out the second half of allocations. to make sure we don't overwhelm limited storage capability and capacity. >> reporter: just how many vaccines would be delivered to statill be based on population. officials saying they are hoping to continue to send shipments out every week as vaccine doses come off the production line but who gets the vaccine first is up to each state. on tuesday, a cdc advisory panel recommending those initial doses be allocated to health care workers and elderly home care residents like those of sunshine retirement living in oregon. >> i believe we will be able to go back to normal with vaccines. >> reporter: other groups like the international association of firefighters now asking for its first responders to be

prioritized too. >> every citizen expects rightfully so for firefighters to be on the front line but they also need to be at the front of the line when it comes to ppe and vaccinations. >> reporter: and it's not just firefighters. many including the governor also calling for teachers to be prioritized during the first wave of vaccines, robin. >> alex, i want to ask you this. the vaccine approval process in the uk, that allowed them to get the vaccine first? >> reporter: well, robin, how exactly the process works really depends upon who you ask. in the u.s., they say the process is a little more rigid and requires the fda to review the data, and in the uk they say they've been reviewing the data along the way and also say they're more organized. let's bring in one of the governors responsible for delivering it, governor larry

hogan, of maryland. governor hogan, thanks for joining us. your state will get allocated 155,000 doses of the pfizer and moderna vaccine. what's your plan to distribute it? >> well, you know, it's not enough even to cover our frontline health care workers. we have about 300,000 of those so our plan which we submitted to the cdc prioritizes the most vulnerable. so our frontline health care workers, our nursing homes and then first responders and as they come in, we just start working our way down that pyramid of a list, and so we're hoping to get maybe 300,000 by the end of december, and then hopefully it's really going to ramp up from there, as production starts to accelerate. >> so you say it's not enough to cover the health care workers at least at the beginning. are they being distributed in a fair way, in your view? >> i think they are. you know, i've been critical when i thought that things weren't going well at the federal level. i think "operation warp speed" is a tremendous success, and all

of the communication that we've had with the folks at the federal level has been great and they have a good plan, i think, in getting these distributed. the question is, how fast can we get these vaccines out there to cover as many people as we can? >> what's your advice to the people of your state waiting for this. we just saw the mayor of los angeles eric garcetti say cancel everything. >> well, you know, sadly this is -- the darkest days are yet ahead, and hearing the statistics you were just talking about earlier, the worst part of this virus is still coming, and in the weeks and maybe the month or two to come, and we're not going to have enough for everybody, so we're just asking for patience. the good news is the cavalry is on the way. there is a light at the end of the tunnel, but we've still got some pain to go through before we get -- before we even get this under control. >> and not everybody is yet convinced that it's safe to take this vaccine. >> well, it's really important that we are able to convince people it's safe. i mean, some of the polling showed that somewhere over 50% of the people don't feel like

they want to get a vaccine. we can't get this under control unless we get somewhere around 70% or more of the people to be vaccinated. >> governor -- >> we still have to do a good job of convincing people. >> we sure do. we saw that moment in your press conference on tuesday where you teared up as you were talking about the death of that 1-year-old who suffered from covid. the magnitude of the crisis really seemed to hit home for you in that moment. >> well, you know, we talk. we have these press conferences and talk about the deaths and record deaths and record hospitalizations and every one of them is an important life and we sometimes get confused with talking about numbers but when i was talking about our youngest 1-year-old who died, it just hit me -- i was thinking about my grandkids and thinking about those parents. >> and, governor, have you made contact with the biden transition? are you convinced we'll have a seamless transition when it comes to "operation warp speed," vaccine distribution dealing with this pandemic?

>> yes. well, i was concerned about that at first, but i'm feeling much better about it. with the leadership of the national governors association, we had a great conversation with president-elect biden and vice president-elect harris. i'm very pleased that it sounds like the coronavirus task force and the current administration is now including them in briefings and bringing them up to speed because it's really -- we're in the middle of the worst battle of this war, and the handoff has got to be smooth. we've got to work together. there's got to be in politics in this virus. >> governor hogan, thanks so much for your time this morning. >> thank you. >> michael. george, a lot of hope for the vaccine and also a lot of hope for new relief packages to help millions of americans hurt by the economic downturn, but time is running out to make a deal. senior congressional correspondent mary bruce is in washington with the very latest. good morning, mary. >> reporter: good morning, michael.

well, there is cause for optimism here in washington this morning, but this is far from a done deal yet. so here's where things stand. democratic leaders are now backing this new bipartisan compromise bill and the president-elect joe biden is signaling he supports it too. even if it's just a start. this is a big concession for democrats because this bill falls far short of what they've been demanding all along. what it would include is $300 in weekly unemployment benefits and $160 billion in state and local aid which is something the republicans had been rejecting but would not include another round of those stimulus checks for all americans. democrats are really trying to up the pressure on republican leaders but mitch mcconnell is still backing his own much smaller plan and president trump, well, he hasn't said a word yet about this new compromise. lawmakers are giving themselves one more week to try and sort it out. the bottom line is, the clock is really ticking and with millions of americans really suffering, a deal still isn't in sight just yet. >> so needed. mary, thank you. we're turning to that

wildfire exploding out west overnight due to dangerous winds. rob joins us now with the latest on the critical situation and those mandatory evacuations. good morning, rob. >> reporter: hey, good morning, robin. they use that word critical quite a lot during fire season, but we don't use the word extreme very often, and they put that wording into the forecast last night, and then fires broke out across southern california. here's the video to prove it. silverado canyon, it jumped from 7 to 1,500 acres, called the bonfire. mandatory evacuation orders in place and rancho san diego just to the south the willow fire just 5% contained. there was a structure burning but you see how close that fire is to those neighborhoods there. they think they might have a handle on this, but the winds are going to be blowing just through the afternoon today. we could see gusts over 70 miles, maybe even 90 miles an hour in the mountains, rapid-fire spread with very dry vegetation. there are those extreme areas across san diego. once we get through today we'll

be okay. george, over to you. >> okay, rob. thanks very much. we turn now to the 737 max jet making its first passenger flight since two deadly crashes and boeing is hoping to rebuild confidence and hoping to make its way back to regular service and took a plane load of journalists to test it out. gio benitez is one of those and joins us now with more on that. good morning to you, gio. >> reporter: good morning to you. yeah, this is the max behind me here and these planes may be back in the air, but this morning is whether travelers will be ready to get back on board. this morning, the plane grounded after two crashes that killed 346 people is back in the air, and we are on board. so we are now boarding the boeing 737 max. this is the first time that anyone from the public has flown on this plane since it was grounded nearly two years ago. american airlines flying reporters wednesday hoping to convince the public that the max is safe. american's c.o.o. telling us it is. >> i'm completely comfortable it. i put my family and friends on

it. i have no misgivings. this is a safe airplane. >> reporter: here in the max cockpit you won't see any changes but it has completely updated its flight control system and that's all in the software. that software was triggered in both crashes involving lion air 610 and ethiopian 302 when a faulty sensor gave the wrong information sending the nose of the planes down not once but multiple times. the system now uses two sensors and can only send the nose down once. american airlines pilot peter gamble helped boeing and the faa create new training protocols. >> now that the dual sensors are there all of what happened in the past is prevented because you have two sensors looking at one another, comparing them. if it doesn't like it. it will shut down the systems that it operates that could affect the flight of the aircraft. >> reporter: but some of the families of the victims aren't convinced calling this flight a marketing stunt. >> neither of us would ever get

on a 737 max, and we will warn every single person we know to look at the equipment that they're flying on, and make sure that they don't fly on a 737 max. >> reporter: meanwhile, the first max flight with paying customers is set for december 29th from miami to new york. but how do you know if you've been booked on a max? american airlines says the moment you book the ticket you should get an alert. if you don't want to fly on this plane you can cancel or change your flight. michael. >> all right, thank you so much for that, gio. now to an investigation under way after an unusual lottery drawing. the winning numbers, 5, 6, 7, 8, 9 -- >> oh, come on. >> and, robin, you guessed it, 10. yes. 20 people in south africa chose that sequence and they took home about $370,000 each. another 6,000 chose 5 through 9 and took home a smaller sum but

lottery officials say there's no way to rig the game so enjoy your winnings. >> yeah, good for them. we are following a lot of other headlines this morning, including the latest in the holiday shipping crunch. u.p.s. is now telling drivers to temporarily not pick up packages from some major retailers. we'll tell you what it could mean for getting your gifts on time. and as we get closer to a vaccine, we're answering your most pressing questions. dr. jha is back with us live again to answer questions that you have. but first, back to rob. rob. >> hey, robin, we showed you pictures of the fires. part is because of the cold air just east of the rockies, and this is i-40 just east of new mexico shut down because of the snow there. time for your windy cities now brought to you by state farm.

i'm abc7 news meteorologist mike nicco. another dry and quiet weather pattern develops today with high clouds and sunshine. no definitive chance of rain in the next seven days. in fact, a heightened fire danger sunday and more so monday. temperatures today about three to six degrees warmer than average. 61 to 66. tonight, mid-to upper 30s inland. low 40s around the bay. patctctctctctctctctctctctctctctc oh, stay right there, tctctc everybody. we're just getting started. we'll be right back. everybody. we're just getting started. we'll be right back. re comes sa, here comes santa claus♪ ♪right down santa claus lane ♪he's got a bag that's filled with toys♪

♪for boys and girls again ♪so jump in bed, and cover your head, ♪ ♪'cause santa claus comes tonight♪ santa knows a gift when he sees one. ♪ ford. built for the holidays. ♪ ♪ >>hey les! her thick red stew's scrumptious scent wafted out of the window. hmm, be right back. ...mmm...

...mmm...story time got auntie leslie a little hungry. removes ten years of yellow stains. optic white renewal that's like all the way back to 2010. what's that? it's a shake weight. it's a weight you shake. remove ten years of yellow stains with colgate optic white renewal. at target, order today and get it today! just use target same day delivery or drive up. for groceries, gifts and more on your list. it's the fastest way to get what you need, today. at target. when life gets you down and life is just crazy, they think you are the best thing in the world. and that's a really cool feeling. so, yes, cats are awesome. tucker's family so we feed him blue. ...this one's for you. you inspired us to make your humira experience even better... with humira citrate-free. it has the same effectiveness you know and trust,

but we removed the citrate buffers, there's less liquid, and a thinner needle... with less pain immediately following injection. ask your doctor about humira citrate-free. and you can use your co-pay card to pay as little as $5 a month. humira can lower your ability to fight infections. serious and sometimes fatal infections,... ...including tuberculosis, and cancers, including lymphoma, have happened,... ...as have blood, liver, and nervous system problems,... ...serious allergic reactions, and new or worsening heart failure. tell your doctor if you've been to areas where certain fungal infections are common... and if you've had tb, hepatitis b, are prone to infections,... or have flu-like symptoms or sores. don't start humira if you have an infection. ask your doctor about humira citrate-free. the same humira you trust with less pain immediately following injection. if you can't afford your medicine, abbvie may be able to help. if you can't afford your medicine, got the whole fam rockin' ♪ hejingle jam-mays ♪olidays ♪ ♪ our 18th time watchin' love actual-lay ♪ ♪ we gon' have the best holiday here at old nav-ay ♪ shop jingle jammies from head to toe to tail.

we holiday. only at old navy and oldnavy.com data shows hospitals in santa clara could exceed capacity in two weeks. administrators are scratching to ensure there are enough beds, especially in hospitals serving east san jose and other parts of the county. a dozen icu beds available in those areas right now. the impact on hospitals was one reason santa clara implemented several new restrictions on monday, including a

welcome to 15 days of saving up to $500 on fast, in reliable internet and... mobile with nationwide 5g on the most reliable network. welcome to family-connecting, holiday-shopping, black friday awesome. because, for a limited time, when you get xfinity internet and mobile together... ...you can get a $200 prepaid card... ...and up to $300 off select mobile phones... ...for up to $500 in savings. this sale won't last, so click, call, or visit a store today! . . . i had hiv, it was difficult for . . . . . . me to accept. i decided . . . . . . hiv doesn't define me. my name's dimitri. and i'm on biktarvy. biktarvy is a complete, one-pill, once-a-day treatment . . . . . . used for hiv in certain adults. it's not a cure, but with one small pill . . . . . . biktarvy fights hiv to help you get to and stay undetectable. that's when the amount of virus is so low . . .

. . . it cannot be measured by a lab test. serious side effects can occur, including kidney problems and kidney failure. rare, life-threatening side effects include a build-up of lactic acid and liver problems. do not take biktarvy if you take dofetilide or rifampin. tell your doctor about all the medicines and supplements you take, . . . . . . if you are pregnant or breastfeeding, or if you have kidney or liver problems, including hepatitis. if you have hepatitis b, do not stop taking biktarvy without talking to your doctor. common side effects were diarrhea, nausea, and headache. if you're living with hiv . . . . . . keep loving who you are. and ask your doctor if biktarvy is right for you. a little bit of fog to contend with around novato, visibility a quarter mile or less on 101 and 37.

that will be around through the entire morning commute. that's the only game in town. south bay pretty clear and quiet for your commute. at least weather-wise. pretty chilly this morning, 30s and 40s. on your way to upper 50s at the coast, low to mid-60s for the rest of us. watching the fire threat sunday into monday. let's get traffic from sue. fatal accident northbound 101 before 380, car overturned and coroner is on its avoid northbound 101. if you can, take 280. there's a sigalert and no time of reopening. coming up, the holiday shipping crunch. u.p.s. now telling drivers to temporarily stop picking up packages from six major retailers, including sf-based gap. what it can mean for you this christmas. we'll have another update in 30 minutes. until then, here's more gma.

tonight...i'll be eating cheesy cauliflower pizza with extra broccolini. my tuuuurrrrn! tonight...i'll be eating cheesy cauliflower pizza and yummy broccolini! (doorbell rings) thanks. (doorbell rings) thank you. ♪ is that my leotard? no. yes... ehh, you can keep it. during kohl's friends and family esale!.. plus, take an extra 25% off! get sleepwear sets - $20.99... ninja foodi indoor grill is $199.99... and get up to 25% off koolaburra home! plus, get kohl's cash! plus, free store pickup. give with all your heart. kohl's

♪ nice and rosy and comfy back here on "gma." we cannot wait to see more of that holiday special from mariah carey. she is joining us live in our next hour to tell us all about it. >> every time we see her. following the top headlines including that stark warning to brace up to 200,000 more deaths in the next few months. hospitalizations have also hit an all-time high hitting 100,000. there is now hope for the vaccine. pfizer has millions of doses standing by waiting for that approval that could come next week and hope for a new relief package to help millions hurt by the economic downturn. even though time is running out to strike a deal they're backing

a $900 billion plan devised with moderate republicans that could deliver badly needed cash for millions of americans. romain grosjean released from the hospital three days after surviving this fiery crash that split his race car in half and he suffered severe burs on his hands and he said the thought of his children helped him make that incredible escape. and take a look at this rescue on ice. >> ah. >> poor pup stranded right there but a determined emergency worker in fargo, north dakota, was able to wade out and get the dog to safety. >> how did the dog get there? >> good question. >> good question. >> we don't have the answer but good question. >> and we're going to continue with delivery services which are pushed to their limits. u.p.s. reportedly telling drivers not to pick up packages temporarily from some top retailers like gap and nike. will reeve has more on what to expect for the holidays. good morning, will. >> reporter: good morning, michael. americans spent nearly $20

billion online between black friday and cyber monday. all that stuff needs to get shipped and fedex and u.p.s. for months now have been operating at levels typically only seen around the christmas season. you add that all up and the system that millions of people around the country rely on is under severe pressure. this morning, signs of possible cracks in the holiday shipping system. u.p.s. reportedly pumping the brakes on picking up packages from major stores. after a record-breaking cyber monday, the shipping giant instructing its drivers nationwide to temporarily stop collecting orders from six large retailers including gap, nike and macy's. according to "the wall street journal." >> they told these large shippers months ahead of time that, you know, this is your allocation for certain days for certain weeks but if you're going to go over that we're not

going to pick up your packages. >> reporter: consumers spent $10.8 billion online on cyber monday, just three days after a record-breaking $9 billion spent online on black friday. factor in the millions shopping online for household essentials and that could mean a surplus of 7 million packages being shipped per day between now and christmas. something that -- shipping companies were not prepared for. >> it's difficult for them to expand their network in such a short time and handle such a huge surge in the volume for essential items. >> reporter: u.p.s. assuring deliveries will get made. they just might be delayed saying if demand exceeds planned allocations we will work with our larger customers to ensure that the volume gets picked up and delivered. as more capacity becomes available in our network. >> will, what does this mean for all of us trying to get things in time for christmas? >> reporter: michael, tuesday,

december 15th is the big date to keep in mind. that is the cutoff for ground shipping for u.p.s., the postal service and fedex. they are clearly up early working hard to get you what you need for this holiday season, michael. >> i never shop that early but i'll give it a shot. all right, will, thank you so much. robin. as the country braces for the uncertainties of this holiday season we want to turn back to that other big story, viewers are asking some very important questions about the vaccine and so joining us now with some answers is dr. ashish jha, the dean of brown university school of public health. always, always appreciate you spending some time with us, dr. jha. i want to get right to it and begin with a viewer question from sara asking about the time line for who gets the vaccine. >> would you consider teachers essential workers and some of the first to receive the vaccine? >> so, first of all, good morning, robin. thanks for having me on. i would consider teachers essential workers so cdc just put out its recommendations,

health care workers and nursing home residents and workers and after that other essential workers and i'd definitely support the idea of teachers being in that next batch of people. >> they certainly are essential. parents are really realizing that now. if you've already had covid, do you need to get the vaccine, dr. jha? >> yeah, right now the recommendation from the cdc which i agree with is people who have been previously infected and recovered should get the vaccine. we think the immunity from the vaccine will last longer. if you've very recently recovered and you want to wait a little bit of time, i think that's fine if you recovered in the last 90 days, but other than that i think people should get vaccinated either way. >> lisa has a video question about the vaccine trials. >> hi. i'm lisa from wisconsin and my question for the experts is, have any people with pre-existing conditions or compromised immune systems been involved in the vaccine trials? >> it's a great question, lisa.

the short answer is, yes, we've -- most trials are done with healthy people only. these trials are being done with people who are over 65, people with chronic diseases. they're included. we'll get more details on who and how many in the upcoming weeks, but, yes, they have been included in the trials. >> that's encouraging for so many people to hear that, dr. jha. another viewer question from janet, she is asking about children and the vaccine. >> i'm janet gardner from katy, texas. i wondered if you'll be getting the vaccine as soon as it's available and will you also have your children get it as soon as it's available for them when respected medical professionals start getting the vaccine, i think it will instill confidence in the rest of us. so i wondered what your thoughts were. thanks. >> great question. i plan to get the vaccine as soon as i am eligible. i plan to show up on the first day that i'm eligible and get

vaccinated and i'm going to have my elderly parents get vaccinated when they're eligible. in terms of children they have not yet been part of clinical trials and there are new trials starting up with kids. i'll wait for that data and guided by the american academy of pediatrics so may end up waiting on kids. as an adult i will get vaccinated when i can. >> this is a "gma" viewer. her name is robin, great name and sent this question to us on facebook. robin asks, will you have to get the vaccine every year like the flu shot, or is it a one and done like mumps and measles? really great questions. >> that's a fabulous question. not surprising it's coming from a robin. look, we don't know a lot about the long-term immunity from the vaccine. i would be surprised if it's a one and done. i would not -- my expectation is you may need to get a booster, it may be annual. we just don't know so we'll know more information in the upcoming months. >> and the final question from

twitter, dr. jha, will enough people take the vaccine for it to be effective in ending the pandemic as surveys have shown that right now enough people won't take it to develop herd immunity. >> yeah, this is a really good question. even if 30%, 40% of americans get it it will make a big difference but we probably need to get to 70% or 80% of people getting vaccinated to bring it to an end, so we'll have to address people's concerns and hesitancy and really be, i think, work on helping people understand it's going to be good for them and their communities. >> grateful to you and to our viewers for those insightful questions and your responses. thank you, dr. jha. you take care. >> thank you. >> george. >> always brings such great information. coming up, ryan sutter of trista sutter with new details. a real housewife and her husband in a lawsuit about hiding money from the families of plane crash victims. victims.

voce viva. the new fragrance. valentino at macy's the fragrance destination. i know, but that "parker promo" saved me so much on my insurance, i brought you a little something special. parker, state farm offers everyone surprisingly great rates. you're the man, man. when you want the real deal...like a good neighbor, state farm is there.

she offered you a homemade cookie. so when she said your trade in was worth 12 thousand dollars, you believed her. but was it a lie? the cookie? the offer? next time start with carmax and get a custom offer good for 7 days. the way it should be. carmax.

we are back with the "real housewives" star accused with her husband of staging a fake divorce to hide money from the families of plane crash victims. amy is here with that. >> thomas girardi is accused of embezzlement, a federal lawsuit says he took money from a settlement fund to maintain their wealth and public image. this morning, a reality show

scandal. "real housewives of beverly hills" star erika girardi known as erika jayne and her husband tom accused in a lawsuit of embezzling money. >> being broke sucks, and being rich is a lot better. >> reporter: the federal suit alleging the couple is faking their divorce so they can keep settlement money meant for the victims of the 2018 lion air plane crash represented by tom girardi's firm. the lawsuit suing them claiming, while erika publicly filed for divorce, that divorce is a sham attempt to fraudulently protect their money from those that seek to collect debts owed by tom and his law firm. >> the law firm in chicago is saying tuck away this money in this divorce. he's got to presumably give it all to his wife or, you know, somehow have the money assigned to her, and that way he won't have to pay it back to these plaintiffs or to this law firm. >> reporter: the suit also

claiming the couple's lavish lifestyle is fabricated, alleging tom and his firm girardi keese are on the verge of financial collapse and locked in a downward spiral of mounting debts and dwindling funds while choosing to project a public image of obscene wealth at all times. the 49-year-old reality star erika has been entertaining viewers for years as her alter ego in music videos. ♪keep on spending >> reporter: on television, an appearance she says costs tens of thousands of dollars to keep up. >> i think it costs $40,000 a month to do erika jayne, so that's hair, makeup, costumes, wardrobe and the whole production. >> reporter: now the law firm behind the lawsuit, which worked with girardi representing the victims' surviving relatives, calling the allegations against the girardis some of the most troubling they've encountered in the past 25 years. now we reached out to both erika

and thomas. neither is commenting right now, but it's safe to say there is a lot more coming with this one. >> no question about that. thank you, amy. >> a lot more to come because when we come back we have our "play of the day." research shows people remember commercials with nostalgia. so to help you remember that liberty mutual customizes your home insurance, here's one that'll really take you back. wow! what'd you get, ryan? it's customized home insurance from liberty mutual! what does it do bud? it customizes our home insurance so we only pay for what we need! and what did you get, mike? i got a bike. only pay for what you need. ♪ liberty. liberty. liberty. liberty. ♪ ♪ ♪

♪ just one look at you. ♪ and i know it's gonna be... a lovely day. ♪ ♪ lovely day, lovely day. lovely day. ♪ ♪ lovely day. ♪ lovely day, lovely day. ♪ no matter how you celebrate this year, make this holiday extra special with a gift from pandora jewelry. less sick days! cold coming on? zicam® is clinically proven to shorten colds! highly recommend it! zifans love zicam's unique zinc formula. it shortens colds! zicam zinc that cold!

it shortens colds! if you have postmenopausal and a high risk for fracture, now might not be the best time to ask yourself, 'are my bones strong?' life is full of make or break moments. that's why it's so important to help reduce your risk of fracture with prolia®. only prolia® is proven to help strengthen and protect bones from fracture with 1 shot every 6 months. do not take prolia® if you have low blood calcium, are pregnant, are allergic to it, or take xgeva®. serious allergic reactions like low blood pressure, trouble breathing, throat tightness, face, lip or tongue swelling, rash, itching or hives have happened. tell your doctor about dental problems, as severe jaw bone problems may happen. or new or unusual pain in your hip, groin, or thigh, as unusual thigh bone fractures have occurred. speak to your doctor before stopping, skipping or delaying prolia®, as spine and other bone fractures have occurred. prolia® can cause serious side effects, like low blood calcium, serious infections, which could need hospitalization, skin problems, and severe bone, joint, or muscle pain. don't wait for a break, call your doctor today, and ask about prolia®.

♪ save mothis weekend...circle. get 10% off target giftcards. in-store or at target.com. join target circle on the target app. saturday and sunday only. save more with target circle. only at target. we are back now with our "play of the day" and we have the ultimate tag team play from superstar taylor swift and her friend ryan reynolds. now, george, i know you had a

big interview with taylor. >> my daughter got the scoop out of it. >> how lucky is she. taylor spoke about re-recording some of her songs and she just gave us and ryan reynolds an early christmas present with a sneak peek of her recording of "love story." might be a perfect fit for this year. take a look at the new ad for match. >> satan. >> hi. >> 2-0-2-0. >> please. call me 2020. ♪ juliet never have to >> fantastic. be alone ♪ >> fantastic. i laughed the entire way through. ryan reynolds wrote that commercial for the dating set match and writing this caption on youtube, quote, a love story for the ages or at least this age. that video racked up nearly 10 million views and counting, of course, the brilliance of ryan reynolds mixing in with taylor

swift doesn't get any better than that for our "play of the day." >> that was perfect. you have to laugh about 2020 at some point. whoo. okay. no laughing matter, mariah carey joining us live in our next hour. come on back. >> yes. ♪ and i don't care about those presents ♪ don't care about those presents ♪ c'mon guys, hurry! where is everyone? why aren't the lights on? i don't know, sam... seems like everything's off this year. uhm, what's wrong with the lights? got me - nothing's working. hey - mind flipping that switch for me? third time's a charm! wait. what? wow! huh? this is awesome. "well, hello there sam!"

uh, hi. what is all this? know when things are a little off? we turn them on. what does this switch do? that fixes bed head. oops, we might have to reverse that circuit. oh, what about that one there? replaces your goldfish with an exact replica. why would you need that? no reason... whoa, what about that one!? that's the step springer! coool! what are you looking for? i wish there was a switch for my town... oh sam, there is no switch for that. but all people need is a little hope... a spark, to light the way. and that can be in all of us... right here. thank you!! my pleasure!! ♪ be the spark. ♪

yes, i did it! ♪ ♪ during kohl's friends and family esale!.. plus, take an extra 25% off! get sleepwear sets - $20.99... ninja foodi indoor grill is $199.99... and get up to 25% off koolaburra home! plus, get kohl's cash! plus, free store pickup. give with all your heart. kohl's

♪ top down, the city riding with me ♪ ♪ been through the storm and the gritty ♪ ♪ do it for the mom and pop on every block ♪ ♪ new day, sunshine on every block ♪ ♪ windows open, i'm yelling unity ♪ ♪ side-by-side with my community ♪ ♪ celebrate, let's have a jubilee ♪ ♪ it's bigger than you and me ♪ ♪ they've been there for us ♪ ♪ let's be there for them ♪ ♪ they've been there for us ♪ welcome back to "gma" in mamaroneck. it's a chilly start but a lot of rain across our 49 states. we take to you alaska. this is just near juneau so they had several inches of rain in this mountainous area and a landslide that doing out four homes. six people are unaccounted for.

a devastating impact on this community just to the north of juneau, alaska. we'll be updating throughout the day today. this is heading towards the northeast and lower 48 from the gulf states today and eventually by saturday it's going to be a messy day with rain, flooding potentially along i-95 and inland snow. coming up on "gma," lots to share. ryan sutter, husband of trista reveals the symptoms he has in a mysterious illness and james corden and meryl streep tells us about "the prom" and kicking off our two-day "deals & steals" gifts extravaganza.

"good morning america" is sponsored by small unites. support small business. support small business.

building a better bay area for a safe and secure future. this is abc7 news. good morning. i'm reggie aqui. there is a backup on northbound 101 right now. >> wave fatal accident near san bruno past sfo. chp is on the scene and they have issued a sigalert. you can see those red sensors all the way back towards san mateo. so avoid northbound 101 on the peninsula. please take 92 to 280 to avoid this fatal accident. mike? thank you, sue. pretty quiet outside except the beach where there's angry surf through 4:00. temperatures above average once again, 61 to 66. that's a constant throughout the forecast and the lack of rain. reggie? >> mike, thank you. coming up, the one and only

mariah carey talking about her new holiday special and song. we'll another update in 30 minutes. you can catch us on our news app or abc7news.com. until then, here's more "good morning america." great day on the lake! it is. lunch is cookin'! and i saved a bunch of money on my boat insurance with geico. fellas, can it get any better than this? whoa! my old hairstyle grew back. so did mine. [80's music] what? i was an 80's kid. it only gets better when you switch and save with geico.

we have the power to harness california's abundant solar and wind energy, but it's not available all day long. use less energy from 4 to 9 pm for a cleaner california.

good morning, america. it's 8:00 a.m. in 24 hours, more than 3,000 american lives lost to covid-19. the highest number of deaths since the start of the pandemic. with the cdc warning the nation to brace up to 200,000 more deaths in the next three months. and with hope on the horizon, "operation warp speed" revealing how they will get the first 20 million doses of vaccine to americans across the country as states decide who will get it first. help on the way? democratic leaders now backing a $900 billion plan hatched with moderate republicans that could deliver badly needed cash to millions of americans. the latest as time runs out to strike a deal. news this morning. former "bachelorette" star ryan sutter revealing new details about the mystery illness rocking his life. saying, some days it's so bad he

can barely get out of bed. the symptoms he's facing, and the desperate search for answers, and a new message from the couple only on "gma." ♪ jingle bell countdown to christmas. this morning, the holiday side hustles to help you get through the season. who is hiring right now and how to make quick cash while working from home. ♪ all i want for christmas is you ♪ and the queen of christmas is coming to our rescue. mariah carey is here live spilling secrets on her magical star-studded christmas special only on "gma" as we say good morning, america. ♪ ♪ and good morning, america. hope you're doing well this thursday morning. >> yes, can you hear that? that is mariah carey. we cannot wait to talk with her about her brand-new holiday special with so many of our

favorite stars, plus, mariah is also teaming up with ariana grande and jennifer hudson for one of the soundtrack's biggest hits. three powerful voices. >> very powerful. that is ahead. but right now, a lot of news to get to starting with the latest on the coronavirus emergency. hope for the vaccine on the horizon with hospitalizations hitting an all-time high, now topping 100,000. the director of the cdc saying we are on the brink of the most difficult period of the nation's public health history. let's go back to whit johnson at a testing center in norwalk, connecticut, with the latest. good morning again, whit. >> reporter: robin, good morning to you. as cases surge, the holiday season rush on testing continues. let's go ahead and take a look from above. our drone camera overlooking this drive-through testing site in norwalk. many of the cars here lined up hours before the gates even open. this as the u.s. continues to break new painful records in the pandemic. this morning, the u.s. hitting its deadliest single day of the pandemic.

more than 3,100 lives lost in 24 hours and the cdc now predicting up to 200,000 more americans could die in the next three months, a staggering toll that would approach nearly 500,000 by february. >> december and january and february are going to be rough times. i actually believe they're going to be the most difficult time in the public health history of this nation. >> reporter: this as the u.s. hits another milestone. more than 100,000 people now hospitalized with covid. a new record. and more than double the number reported on november 1st. the cdc director revealing that 90% of the nation's hospitals are in a red zone. but hope is on the horizon. government officials expecting emergency authorization of the covid-19 vaccines to come within the next few weeks. >> that means we can make our first shipments of vaccines to states this month and we are on track to be able to ship enough vaccine for 20 million americans before the end of the year.

>> reporter: but who gets the vaccine first is up to each state. on tuesday, a cdc advisory panel recommending those initial doses be allocated to health care workers. earlier this morning, george spoke to maryland governor larry hogan about vaccine preparations. >> your state is going to get allocated about 155,000 doses of the pfizer and moderna vaccine. what is your plan to distribute it? >> our plan which we submitted to the cdc prioritizes the most vulnerable. so our frontline health care workers, our nursing homes, then first responders. >> reporter: and the mayor of los angeles eric garcetti putting it bluntly, telling his residents to stay home, hunker down and cancel everything. george? >> we are seeing stay-at-home orders now all over the country. okay, whit, thanks very much. we're going to go to washington now. there are signs of pentagon for a relief that could help millions of americans. time is running out to make a deal and back to mary bruce, good morning, mary.

>> reporter: good morning, george. there are signs of hope here but this isn't done yet. democratic leaders and it seems now the president-elect are supporting the new bipartisan compromise, even though it falls far short of what they've been demanding all along. it would include $300 weekly federal unemployment benefits and $160 billion in state and local aid, but it would not include another round of those stimulus checks for all americans, and now the question is whether republican leader mitch mcconnell can get on board, he's been pushing a smaller plan, and what about president trump? lawmakers are giving themselves one more week to try and sort it out so the clock is ticking as millions of americans, of course, are really suffering and in need of help. michael. >> clock is ticking. mary, thank you so much for that. coming up, former "bachelorette" star ryan sutter revealing new details about his mystery illness saying some days he can barely get out of bed. plus, we are breaking down how to find some holiday season -- get your side hustles on, y'all. we're hiring right now. who is hiring right now to help you make some quick cash before christmas? and tory johnson kicking off our supersize two-day "deals &

steals" event with gifts for everyone on your list. we'll be right back. ♪ two-day "deals & steals" event with gifts for everyone on your list. we'll be right back. ♪ el, my husband would have been on the sidelines. but not anymore! an alternative to pills voltaren is the first full prescription strength non-steroidal anti-inflammatory gel to target pain directly at the source for powerful arthritis pain relief. voltaren. the joy of movement. now walmart can help check off your gift list with free curbside pickup, fast delivery from your walmart store, or gifts shipped right to your door. let's end the year celebrating. ♪ removes ten years of yellow stains. optic white renewal that's like all the way back to 2010.

they're jeans. they're leggings. they're jeggings! whoa. remove ten years of yellow stains with colgate optic white renewal. no uh uh, no way come on, no no n-n-n-no-no only discover has no annual fee on any card. see yourself. welcome back to the mirror. and know you're not alone because this. come on jessie one more. is the reflection of an unstoppable community in the mirror. when you come home and you've had a hard day at work, and you walk in the door and she just looks at you like you are sunshine, it's just, there's no other feeling like that. isn't that right bebe? bebe's family so i feed her blue.

to give you the protein you need with less of the sugar you don't. [grunting noise] i'll take that. woohoo! 30 grams of protein and 1 gram of sugar. ensure max protein. with nutrients to support immune health. she offered you a homemade cookie. so when she said your trade in was worth 12 thousand dollars, you believed her. but was it a lie? the cookie? the offer? next time start with carmax and get a custom offer good for 7 days. the way it should be. carmax. why not bring the holidays to a vrbo vacation home.

somewhere with more space to get closer your together awaits. with vrbo walmart makes it easy with groceries, gadgets, and soo much icing. let's end the year deliciously. ♪

♪ there you see it right there you, 22 days to go until christmas. we're counting down right here and helping to spread holiday cheer and we asked you to send us your photos and a lot of you responded. >> they certainly have. take a look. jackie from cedar lake, indiana, sent these. look who is hiding out. those are her cats, carrie and jeannie, and here's another one from jeannine from keyport, new

jersey. beautiful. >> leia and linda from virginia decided to project a tree on their house to share the christmas tree with their neighbors. how sweet is that? use the #gmaseeyourtree. >> brightening up the holidays for all of us. we turn now to our "gma" cover story. ryan sutter, husband of trista sutter opening up about how he's fighting a mysterious illness and the symptoms he's been struggling with. erielle reshef has details. good morning. >> reporter: good morning. ryan says he has been facing severe flu-like symptoms and fatigue for the last five months and now in absence of a diagnosis he says he's sharing his story to help others facing similar frustration. >> will you marry me? >> reporter: this morning, "bachelorette" alum ryan sutter opening up about suffering often debilitating symptoms of a mystery illness. in a series of revealing instagram posts the former nfl star turned firefighter writing

he's continuing to work while experiencing fatigue, sometimes almost paralyzing. deep body and muscle aches, fevers, night sweats, full body itching with no rash, headaches, neck and throat swelling, congestion, light-headedness, nausea and just general all around not feeling good saying most days i feel about 70%. some days i feel a bit better and some days i can barely get out of bed. just days ago sutter's wife of 17 years trista expressed deep concern about his ongoing health battle in an emotional post. sutter says he's tested negative for covid-19 several times and doctors have also ruled out cancer. but so far a diagnosis has been elusive. i do not appear to be alone in this experience, he writes. the struggle to find answers in the medical world and support through the insurance industry is frustrating and lacking. the couple who met and fell in love on the first season of "the bachelorette" in 2003 now have

two children. sutter says he hopes going public will help others. i feel well prepared to take on my current health situation. i have a strong support group and the best wife in the world. please don't worry about me. in an exclusive statement to "gma," the couple says, thank you to everyone for the overwhelming amount of support and sincere concern in regards to recent news concerning my personal health. we will update you when we feel progress has been made and it is appropriate to share. and in that statement to "gma" ryan and trista express their gratitude for all of the well wishes but said moving forward they hope everyone will respect their privacy as they focus on the unknown battle ahead. >> thanks very much. let's bring in dr. jen ashton for more. so scary and so frustrating. how common is it for people to go to the doctor and not get answers? >> george, i think it's more common than people think especially in people who are suffering from a so-called rare disease. it can take five to seven years

before they get a diagnosis but from the medical standpoint, i think it's really important for people to understand that there is an art and science to the practice of medicine and sometimes the best doctors are not the ones who think they have all the answers, but the ones who actually know the right questions to ask and also sometimes it's just as important to know what something isn't as it is to know what it is. >> right, ruling out things one by one. what do you recommend to people facing a situation like this >> there is no one right way and you have to find what works for you, but there are general tips. first of all, be persistent, don't give up and be your own advocate. that doesn't mean fighting with the medical system but working hand and hand alongside the medical system even though that can be frustrating. i think keeping your medical records organized in your possession is critically important and then tracking your progress. you don't want to make this into a science project but keeping a diary of sorts so you can track what makes things better, what makes things worse and,

remember, this might be a course that's measured in baby steps, not in a light switch of all of a sudden you feel miraculously better. it's a very hard process. >> jen ashton, thanks very much. robin. we're going to turn now to how some people are seizing some promising opportunities with holiday season side hustles to make side cash as we count down to christmas. rebecca jarvis is here with more on all of that. good morning, rebecca. >> reporter: good morning to you, robin. well, whether you have a special skill set or some extra time on your hands, these side hustles are in demand right now and can help you earn some extra cash right away. 'tis the season for the side hustle. with more than half of americans looking for additional income this holiday season, there's still plenty of opportunity to make some quick cash. >> i worked taskrabbit because it allows me the ability to

create my own schedule meaning i decided how much i was worth. >> reporter: this woman is a clinical social worker who uses taskrabbit to supplement her income. >> seasonal work is huge from thanksgiving to the new year. taskrabbit isn't just about the individual. small businesses, medium businesses and large businesses use taskrabbit. >> reporter: there are apps like shipt, humtack and instacart. don't want to leave home, sites like usertesting.com pay from $10 to $120 to test a company's website or app before it goes live. >> you can still make a substantial amount of money between now and the holidays and beyond. >> reporter: what about seasonal hiring? accorded to linkedin, there are still 24,000 openings right now with companies like target, walmart and amazon, plus macy's telling "gma" exclusively they will host their final national holiday hiring event today filling seasonal roles across more than 250 stores across the country. >> when we think about

e-commerce and uptick this year, if that continues beyond the pandemic, we anticipate seeing an increase for these roles to not only maintain but to continue. >> reporter: while these side hustles will help you earn extra money they have the side bennett of help you build relationship, find new things you find joy in and, robin, they can even help you build a new business for yourself and build a new career path. rock -- robin. >> so many benefits you might not even be aware of. you got that right. thank you, rebecca. let's check again with rob. rob. good morning again, robin. want to update you on what's going on in southern california. with the extremely critical fire conditions last night. a couple of fires breaking out. this one continues to grow in silverado canyon, california. mandatory evacuations in place. and people are urging people that if you are under that, get out. this one also growing in southern california in san diego or near san diego, look at how

close that is to homes there. certainly concerning with these winds that could gust 70, 80 plus miles per hour today. rapid fire spreading, dry vegetation, next 24 hours will be dicey with red flag warnings up and we're watching in goo. i'm abc7 news meteorologist mike nicco. another dry and quiet weather pattern develops today with high clouds and sunshine. no definitive chance of rain in the next seven days. in fact, a heightened fire danger sunday and more so monday. temperatures today about three to six degrees warmer than average. 61 to 66. tonight, mid-to upper 30s inland. low 40s around the bay. patcar time now for our two-day "dea ♪ time now for our two-day "deals & steals" gift extravaganza. tory johnson is kicking it off with kitchen favorites. all you have to do is point your

cell phone camera at that qr code right on the screen to find them. good morning to you, tory. and we're going to start with this revolutionary wine purifier. what you got? >> yes, good morning, michael. this is ullo, it is the easiest way to enjoy a pure wine experience. it's a teeny little smart device that sits on top of any wine got goblet or it could even go on top of a decanter as they show there and you just pour the wine right in. there's nothing complicated about this. the purifier removes the sulfites and it also aerates the wine to bring it to its natural state and their decanter combo also helps to bring back kind of the time-honored tradition of decanting so a couple of good options from this company. all 50% off, starting at $40. that's a great deal. >> so easy, i could do it. here we go.

want to spice your kitchen up. you have these colorful knives for us. >> we do. so one of the finest names in kitchen cutlery is zwilling and we have this great color block knife set and what's great is this is just kind of color that's inspired by fruits so it adds a pop of cool factor to your kitchen instantly and then you get some great tools with it. there are three knives, some shears and a sharpening steel so you'll wind up putting everything to good use on this one. it's slashed in half. today it's $90 and free shipping. >> we love free shipping and these aren't your ordinary pans. what sets these apart? >> so green pan is known for its healthy ceramic nonstick cookware. they are one of the leading authorities in this space. easy to clean, easy to use, we've got a variety of sizes of frying pans.

you can't go wrong with these. they won't emit harmful fumes so it's a great option depending on what you need to add to a kitchen or to gift to somebody. today they are 50% off so the single to sets range from 25 to $50. >> most think you feed a green thumb to grow a garden, but this is an indoor veggie garden. how does this work? >> hamama started by two students who met at m.i.t. and engineered a fail-proof way for to us grow greens without a green thumb. a week ago i called billy backstage at "gma" and i asked him if he would set one of these up for me. i think he panicked for a second when he realized all he had to do was add water. even though quite frankly billy can do anything. and voila, one week later you've got what is sitting in front of you so you can grow micro greens great for salad, smoothies, lunch or dinner, is ready in a flash. all sets are 50% off and start at $19.50.

>> good job, man. you know, tea makes a great gift, tory. you have something straight from india? >> it does. yeah, vahdam teas, oprah's favorite things. delicious teas and phenomenal packaging. depending on the type you like there's options from herbal teas to chai teas, a whole bunch of options from india's gardens to your cup. i don't know i've ever found packaging prettier. all are slashed in half. $7.50 to $30 and then last, michael, i know i watch all of your cooking instagrams. this is the powerxl air fryer. this air fryer does a lot. 8 in 1. air fry, grill, roast, rotisserie, bake, broil. you name it, and what's great about this one, it's the extra large capacity. they make a variety of sizes. this is the extra large campaignsty to accommodate families. you'll get lots of accessories. this one slashed in half, $110

and free shipping on this one. >> we used the air fryer last night and sofia made sweet potato fries. >> yum. >> yum is right. >> yum is right. you're not going anywhere. you have more deals coming up in our next hour. >> we do. >> you stay right there. more coming up for everybody. going to go to george. thank you, michael. we go straight to robin, because you have something special to announce this morning on your thriver thursday. >> breaking news, here, the exclusive, thriver thursday series has been incredibly well received. so thankful for that and it has resonated with many. spotlighting people who have overcome challenges and in the process have inspired others so i'm excited to announce that i will be hosting the inaugural thrivership awards where we will honor thrivers and this year, we're going to celebrate those who have shown great courage and it's been a difficult year, let's face it, and thrivers like first responders, we're thankful for them. the brave crusaders that are fighting for social justice. >> you are hosting.

you have a great lineup as well. >> i am really humbled by thise. we have so many wonderful celebrities who have agreed to join us. we're pulling out, like, "dear evan hansen" star jordan fisher, and that super bowl champion from the kansas city chiefs, tyrann mathieu, the night kicks off on december 10th, abc newslive at 9:00 p.m. with a look back at some of our favorites and the virtual awards start at 10:00, and we cannot wait to honor some very deserving people. i promised michael strahan you'll hear it here first. remember when we were doing thriver thursday and i said, you'll hear it here first? i stole it from you. you were supposed to say it. >> we will hear it here first. i'll let you two finish. >> you can come on. >> i'll go behind. >> six feet. mariah carey coming right up. >> announcer: tomorrow, wake up with bebe rexha. and a performance that will make everyone jealous. ♪ i'm jealous >> announcer: bebe rexha tomorrow on "good morning

america." sponsored by carmax.

. building a better bay area for a safe and secure future, this is abc7 news. >> good morning, everyone. i'm kumasi aaron. crews moved san francisco's new fire station into place. this video shows the floating station at pier 22 1/2. it's along the embarcadero near harrison street. crews moved it across the bay from treasure island overnight. because it floats, it can withstand earthquakes. >> we have a fatal accident still out there, north 101. sky 7 is over it near san bruno. you see the two right lanes are blocked. it's a fatal accident, coroner is there. they're hoping to have this open sometime after 9:00 a.m., so avoid 101 in the northbound direction if you can. you can see the backup there starting to build all the way back to san bruno. take 92 to 280.

>> thank make your holidays happen... at ross! surprise! ahhh! yes! i love it! you don't have to spend a lot to give a lot to the ones who mean the most. you've got the holidays, and we've got you, with the best bargains ever... ...at ross. yes for less!

yep! get the gifts you love... yesss! ... for everyone on your list. you've got the holidays, and we've got you... with all the gift for less. at ross. yes for less! good news, especially for your commute if you're just heading out. most of the fog is fading. visibility anywhere from six to ten miles. san jose is really the only issue other than not forgetting the coat you're wearing. temperatures in the 60s all seven days. >> thank you, mike. we'll have another abc7 news

update in about 30 minutes. but you can also find the latest at abc7news.com. ♪ i don't want a lot for christmas ♪ ♪ there is just one thing need ♪ and i don't care about those presents underneath the christmas tree ♪ that's mariah's classic number one hit, "all i want for christmas is you," which celebrated its 25th anniversary last year. >> no way. >> 25 years. >> and right now mariah carey is joining us live bringing us some much needed holiday cheer with mariah's magical christmas special. let us give it up here in the studio for mariah carey, the one and only. [ applause ] getting up bright and early to be with us. thank you. looking beautiful as always. and i have to say, cannot wait to see the special but first of all, we know it's been a challenging year and the holidays are going to look a little different for a lot of folks. so how is your family going to celebrate, mariah?

>> well, first of all, good morning, guys. i can't see you, but i can feel the spirit within you for christmas. we've been having -- we've been really trying to adjust and i think the main thing that we're, you know, it was just about the kids being able to adjust to not seeing their friends and really staying super careful and it's been hard but i've been working on this christmas special since last february and then the world kind of went, you know, everything that happened this year and we just have been really staying prayerful, staying hopeful and knowing that at the holidays we're going to celebrate, safely, and that's why it's important for us to kind of just like push past it emotionally, but we're being very careful and it's been tough, but i have to say i'm really proud of the kids for adapting and for all of us for adapting. >> good for them. we do need this more than ever.

tell us about the special. >> so, it's a magical christmas special, "mariah carey's magical christmas special" with apple tv plus and it's been so much fun really -- it's been a task because we've had to be covid compliant with everything like when we did the performances, we had planned to do this out of this world special last february, as i said, and then we all kind of had to put our hats on and we worked with award-winning producers and folks at apple were so incredibly supportive to make sure this special happened because i was like, we can't let them foil christmas. it has to happen. so we were so fortunate to have special guests, incredible guests, performances with ariana grande, jennifer hudson, snoop came through in a very festive way, jermaine dupree -- he was festive. i'm not lying.

it's his favorite time of year as well. tiffany haddish narrates. she's so incredible. billy eichner, one of my favorite people, my gosh, misty copeland does the -- it's so early for me. it's early yet late. you know i'm not a morning person. the sugar plum fairy dance and showed up. she's incredible. michael michele harris from "mixed-ish." my kids roc and roe are there. we got together and we were super careful and i just think it's a way that people can share in the holiday spirit with us all and kind of like push past the moment even if it's just for that, you know, amount of time we're watching the special together. i'm just excited because i know my fans are going to have festive moments and, you know, for anyone not a fan we tried to embody like this spirit of positivity to push through for

christmas and i do that every year but this year it was even more important so, yeah, here we are and it's christmas already. i'm excited. i was scared. i told story. i was scared when everybody was buying paper towels. i was like, do i have to buy christmas lights. what if we can't get christmas lights? what are we going to do? i can see you guys now finally, yay. >> but you said, mariah, you've been working on this since february. that's before we really knew how this year was going to go which in a lot of ways make this more special because a lot are leaning on the holidays for a little bit of hope. that must make that extra special for you. >> it really truly does and it's not just -- i'm saying this from the heart, like i wouldn't feel happy if i couldn't celebrate with fans this year and just with the world. like it's just been so traumatizing like what happened this year but i think pushing through and the way things are kind of changing for the better. pushing through with this holiday season for me was super important.

and i'm just, you know, i'm just being festive in spite of of everything and we're home and it's -- it is what it is. like it's just about your heart. for me it's really like it's there, it's real, you know. >> we need this, mariah. bless your heart because we really, we really need something like this. we know how hard you work and we know how hard you worked on this and you were talking about tiffany haddish and misty copeland and billy and all these people. do you have a special memory of the taping that we're going to be able to see? what were some things that come to mind when you think about all the hard work and what did you take away and are going to remember the most? >> it's been interesting because watching the whole -- the special developing and come to life, there are new things every day because working with a partner like apple is kind of like you know, you are working with such creative people who have access to so much in terms of the technology and all the things we put into the special to make it festive during this crazy year and, you know, so

every moment is a great moment for me. i enjoyed every moment making this christmas special and the throughline of is little mimi, michael michele harris, and she's kind of -- she's kind of lost her -- she's a little girl, 8 years old and not into christmas this year. by the end of the special she has another moment, so it's been really fun and friends with roc and roe so it was fun for them. i also have to talk about my book. we deal with that in the special, the meaning of mariah carey out this year, that was the whole thing, we went straight into the filming for this christmas special so it's been a big year for me even though i've been doing everything from home and i just wanted to thank everybody who has been so supportive and tell you i'm here, let's do christmas together and be fun and festive and safe. >> we got to say that book made you a number one "the new york times" best-selling author on

top of it. mariah, thank you so much. thank you for bringing positivity and christmas cheer to us this morning here at "gma" and we look forward to seeing your special. we cannot wait for it. >> lady in red. >> thank you so much. >> lady in red. >> lady in red. >> bringing it this morning. >> yes. "mariah carey's magical christmas special" is available on apple tv plus tomorrow. so make sure you watch it and get in the christmas spirit and the soundtrack drops exclusively on apple music tomorrow as well and all other platforms on december 11th. coming up, we have meryl streep and james corden, they're

[[sfx: bing bing bing ] [sfx: bloop bloop bloop ] [ sfx: bing bloop ding ding bloop bing ] the day can wait. enter the golden state, with real california dairy.

we are back now with a dazzling new movie that has fans lacing up their dancing shoes and breaking out that high school tux, the star-studded cast of "the prom" is heading to your living room including meryl streep and james corden who spoke with t.j. who is over there and dancing. i see you moving and grooving. >> okay, meryl streep, james corden, keegan-michael key, kerry washington and nicole kidman are in this movie. this is a movie -- i assure you, you have my word when you see it you will laugh, you are going to cry and, yep, it is going to make you dance. >> this is the part where we roll up our sleeves and put on a prom with our own bare hands. >> reporter: you are cordial by invited to "the prom chl" ♪ it's time to build a prom for everyone ♪

>> reporter: based on the critically acclaimed 2018 broadway music, "the prom" follows four self-absorbed, narcissistic broadway actors looking to reinvigorate their careers by becoming celebrity activists. >> we're cultural -- >> reporter: they're helping a lesbian student who was banned from bringing her high school girlfriend to the prom. >> it was based on a true story. something that happened to a young girl who was not allowed to bring her girlfriend to the prom and i think people have evolved largely on this subject but there's always room for improvement. it's a personal story, but it's one that kids go through everywhere, not just in the middle of the country. >> i have friends of mine who are still yet to come out to their families for fear of how that would be received.

i think this is a story that tells all of those people that there is hope and there is a world out there that offers acceptance and doesn't care who you love. >> i just want to go to prom like any other kid. >> why so quickly were you all on board? >> well, it was typecasting, you know. [ laughter ] roll out of bed and do it. self-centered, you know -- narcissist who wears beautiful clothes all the time. >> where is my suite? >> we don't have a suite. >> now do you have a suite? >> and it's not a message movie, it's something to enjoy and lift your spirits in a very dark time. >> how much fun were these rehearsals? >> there were days when we would rehearse with the whole company

where you really could have thought we were rehearsing for kind of a regional touring production. it just so happens to be starring two academy award winners, you know. it was -- those things, that joy, the joy of the film is really the beating heart of all of it. how it start, how it ends. we really, really hope it's uplifting to anybody who sees it and it doesn't exclude anybody. all generations of a family can watch and enjoy the film. ♪ it's time to dance >> the movie is based on a broadway play based on true events. 2010, constance in mississippi was told she couldn't go to the prom. they cancel, because she wanted to go with her girlfriend. she had to sue and they sent her to a decoy prom. it happened to someone. as we talk about our prom experiences, it's good to remember there are other kids who have memories and experiences who weren't allowed

to go to their prom for different reasons. it's feel good at the end but will make you dance. other kids don't get the prom, some of us had. >> who was your prom date? >> you know -- who was my prom date? oh, my goodness. >> oh, boy. >> oh, wow. >> that memorable. >> hopefully your prom date isn't watching. >> constance, yes. whoo! >> no last name? >> myron cook. >> oh, wow. >> myron cook. >> i didn't have a prom. there was just two of us at high school. i graduated with a class of two. embarrassing to ask her and she said no. we never had a prom so i should watch this movie. >> you should watch it then. >> everybody has different memories. >> robin, i've been here for six years and you've never stumped me on the air until that moment. >> raise it up. it can be done. "the prom" premieres on netflix, december 11th. now to rob. got you. nice work there, robin. good morning, guys. we had a messy storm this past monday.

we're going to have another one in the next couple of days. here's how it will wrap up. southeast, mid-atlantic and then the northeast, i-95 corridor on the day saturday and lingering to sunday. mess of flooding and inland wind as well. not as damaging as last time. as good morning. i'm abc7 news meteorologist nike nike. a little bit of fog in the north bayion. high clouds and sunshine the rest of the morning into the afternoon. temperatures above average, low to mid-60 now to a perfect story in this season of giving. so many schools, of course, are using virtual learning for safety right now. but there are millions of students who don't have the computers to connect to their remote classes. well, two students saw that need and they found a way to help. bridging tech is the brainchild of current stanford students

isabel wang and margo bellon and they match families with refurbished laptops that are theirs to keep, a need borne out of the pandemic. >> around 11 millions students in the united states do not have a laptop so the digital divide is more acute than ever. without technology students are being held back. >> reporter: their fund already donating over 400 laptops in the san francisco area that need them the most. with the help of corporate device donations, as well as fund-raising from over ten countries around the world, ranging from 5 to $5,000, the sky is the limit. >> we plan on giving another 400 laptops to learning within the next two months. >> reporter: they've also enlisted the help of over 30 volunteers. >> we have all hands on deck today. >> reporter: mostly stanford fellow classmates, local high school students and local nonprofit partners, together they make sure the computers are functioning properly so they can

get connected and get online as soon as possible. >> a lot of the families have never owned a computer so this gift is a way for them to connect with their school but with their peers, with, you know, gives them a sense. of mental health and the families a little bit of stability. >> reporter: not just laptops. bridging tech also launched tutoring and mentorship programs that specialize in areas like computer science. >> we got six today. this is great. >> reporter: wang and bellon now hoping to continue expanding the program to other areas around the country and to change as many lives as they can along the way. >> our general advice is, younger than 2013 is viable technology for us to refurbish, but otherwise we can really exchange a lot of this technology with local refurbishers so everything helps. we hope that bridging tech is here to stay. >> giving tech, i love it. good on those two college students, giving stuff away. tory's not quite giving it away but "deals & steals" are close, the extravaganza continues after this break. stay with us.

"gma's" season of giving is sponsored by chick-fil-a. visit the chick-fil-a website to view the film and share a message of hope this holiday. view the film about the covid-19 virus. it's real. and it's dangerous. so, on behalf of all of us working on the front lines, please take it seriously. and while we don't yet have a cure or a vaccine, we do know how to keep you and your loved ones safe. wear a mask. wash your hands. stay six feet apart. do your best to stay out of crowded spaces. and get a flu shot, it's even more important this year. we can do this. if we do it together. businesses today are looking to tomorrsetting the course.ating. but new ways of working demand a new type of network. one that's more than just fast. you need flexibility-

to work from anywhere and manage from everywhere. advanced technology. with serious security. and reliable coverage, nationwide. forward-thinking enterprises deserve forward-thinking solutions. and that's what we deliver. so bounce forward, with comcast business. (har(betsy) twelquarter mile of tinsel. lights. (harold) and real snow all the way from switzerland. (betsy) hmmhm... gonna be tough to top. ♪ (betsy) well played. (vo) add some thrill to your wish list. at the season of audi sales event. get exceptional offers now.

♪ rocking around it is time for part two of our "deals & steals" gift extravaganza. just point your cell phone camera at the qr code on the screen to find these and, tory, you start us off with something the whole family can do together, puzzles. these are truly unique shapes. >> madd capp. they are incredible. they are kind of life-like animal puzzles based on real photographs, they are incredibly challenging. that tiger and raptor you have in the studio are hours of fun. there's three different sizes and a lot of animals to choose from. they're all slashed in half, $7.50 to $10. >> i love that.

something you can do with the whole family. these next are great for kids. they're educational, tory. >> they are. so be amazing is the brand. we have a huge assortment of toys. their little mystery pets, new ones called snow pets that are really fun and exciting and all of the other toys are designed to teach something educational. chemistry to anatomy. there are a lots of hours of fun which is what you want in toys as well as that sort of hidden education. all slashed in half and start at $6.50. next we have augmented reality hyper photo. this is a perfect present if you have somebody who's a tech lover. how do these work? >> yeah, or a selfie lover who loves looking at -- taking photos and then looking at photos of themself from life print. you print all the photos from your phone right to your device and you can add borders and designs and fun things. if you use their app you can see your photos with that augmented reality. it's pretty awesome. it's a very hot gift this

season. and it's 50% off so our deal starts at $50. >> all right, that's great. i see some of our staff like to look at themselves and took pictures for me to check it out. >> there you go. >> and here we have these chic face masks and headbands. what takes them so popular. >> yeah, this is lele sadoughi. it's gained tremendous popularity. we have their embellished headbands. they have details like pearls in them. face masks, lots of combo sets and in both sizes, so mom and kids or twin sisters who like to coordinate. there are a lot of options all 00% off and start at $12.50. >> i see they latch behind on a button so it doesn't get behind your ears which is a great idea. we have a "deals & steals," a favorite, ornaments and banners from you the fan. >> these are great for any sports lover in your life.

you can decorate your tree with ornaments, they're 3d and have stadiums and logos and banners. these are a terrific gift if you love your team, they're slashed in half, they start at $5 and our last one is pudus. the ultimate comfort for the whole family. sherpa lined interior there. slippers, headbands, you name it, all slashed in half for the whole family. $8. are you guys taking my deals? are you stealing the deals? >> robin snuck in and stole the saints. >> i left the giants behind. >> she left the giants behind. most of the league has too. it's all right. we want to thank you, tory. we partnered with all these brands on these deals. you can get them on our website and tomorrow more holiday deals for day two of our extravaganza. stay right there. ♪ oh, oh, oh, ozempic®! ♪ (announcer) once-weekly ozempic® is helping many people with type 2 diabetes like emily lower their blood sugar.

a majority of adults who took ozempic® reached an a1c under 7 and maintained it. here's your a1c. oh! my a1c is under 7! (announcer) and you may lose weight. adults who took ozempic® lost on average up to 12 pounds. i lost almost 12 pounds! oh! (announcer) for those also with known heart disease, ozempic® lowers the risk of major cardiovascular events such as heart attack, stroke, or death. it lowers the risk. oh! and i only have to take it once a week. oh! ♪ oh, oh, oh, ozempic®! ♪ (announcer) ozempic® is not for people with type 1 diabetes or diabetic ketoacidosis. do not share needles or pens. don't reuse needles. do not take ozempic® if you have a personal or family history of medullary thyroid cancer, multiple endocrine neoplasia syndrome type 2, or if you are allergic to ozempic®. stop taking ozempic® and get medical help right away if you get a lump or swelling in your neck,

severe stomach pain, itching, rash, or trouble breathing. serious side effects may include pancreatitis. tell your doctor if you have diabetic retinopathy or vision changes. taking ozempic® with a sulfonylurea or insulin may increase low blood sugar risk. common side effects are nausea, vomiting, diarrhea, stomach pain, and constipation. we have the power to harness california's abundant solar and wind energy, but it's not available all day long. use less energy from 4 to 9 pm for a cleaner california.

just how much visibility your car's headlight bulbs can lose before burnout, so we've taken away 50 feet of visibility from this walk home. don't wait until your headlight bulbs burn out. switch to sylvania, the #1 automotive lighting brand, and see better tonight. before we go, use the qr code on our screen to take you to our website and holiday guide. where is that? i got it right here.

building a better bay area for a safe and secure future, this is abc7 news. >> i'm kumasi aaron. here's mike with a look at the forecast. >> thank you, kumasi. we start by talking about your activity plan for today. it's going to be pretty quiet unless you're at the beach where until 4:00 we have the risk of sneaker waves and rip currents. let's take a look at the temperatures this afternoon with high clouds and sunshine. 61 to 66. my accuweather seven-day forecast lacking in rain, in fact, getting warmer next week, 70s in the forecast. heightened fire danger mainly monday. >> we're still going back to northbound 101 near san bruno. chp issued a sigalert about 7:15 this morning for a fatal accident that's still there blocking the two right lanes. estimated time of opening hopefully within the next half hour. you see the sensors, it's still slow from broadway burlingame.

we'll be back at 11:00. join us then. in the meantime, have a good >> announcer: it's "live with kelly and ryan!" today, from the new thriller, "wander," heather graham. then, stocking stuffers for everyone on your list. plus, find out what happened to a couple after they sat in line for the studio audience. tamron hall joins ryan at the te "live" cohost desk. all next on "live!" ♪ [cheers and applause] and now, here are ryan seacrest and tamron hall! >> ryan: hello. >> tamron: oh, hello, hello. >> ryan: good morning, tamron hall. nice to see you this thursday, december 3rd. it's like having a family member come visit during these times. >> tamron: we don't get to see each other that often.