>> today on "earth focus," neonicotinoids. is the world's most widy y y y pesscide destroying the base of the food chain? coming up on "earth focus." >> they're a mutagen. >> they're extremely persistent >> they are now found routinely in stream samples as well as well samples across the ununited statates. >> if it's gooing to affecect everything from honeybees to earthwoworms, uh, that iis seris >> neonicotinoids are among the most widely used pesticides in the world. they bring in billions in profits for the companies that make them. but now, growing evidence shows

that t these insecticides only killing target pests, ththy are killing many beneficial species and desestroying the e e of the food chain. thisasas happened before. are they the new ddt? insecticide that kills things it shouldn't. >> we've been somehow railroaded by agrochemical companies intnto relying entirely on their productcts. >> and i thinknk we should be really concerned. >> it began with honeybebees. bees began to abruptly disappear from honeybee colonies. since then, beekeepers haveve bn losing 30%0% or more of ththeir hives annuallyly, losses that ae phenomenon came to be called colony collapse disorder.

new york state beekeeper jim doan saw it firsthand. >> i''ve worked in bees for now 46 years, and so i know what normal looksks like, and whahat we've seen over t the last 6 or7 yeaears is not normal. >> honeybeeososs ha consequencesoror thecononomy e-e-thirof f fooproducucucucucue lllinaon.. >> we are putting at risk several hundred billion dollars of produ e everyear.r. it i is significanant because te some of them that really add diversity and vitality to our diet. >> hoybybee sseses he beenen link t to muiplele ftors,, grgradatn, m maltritioio pathons, and rrrroa me infestation for pesticide manufacturer bayer crop science, the issue is clear. >> most expes s agree that the

single greatest thatat to honeybee heah h is t vararro mite, an iasasive ood-d-suing st thatoth didictly pasitizesyoung anadult be and vectors bee diseases. where varroa mites are absent or well conntrolled, honeybees are thrivingng. >> but jim says he knows why his bees are dying. >> we had a multitude of neonics that were showing up in our bees. it doesn't take much to kill a bee. > neonicototinoids are a relatively new class of ininsecticicide and coming on ne scene in the 1990s. it isis the fafastest-growing group of >> for the companies that make them, neonicotinoids, or neonics, are big business. they bring in over $2.6 billion a year in global sales. they a a a a a a a a a a a a a a treatments, applied as soil drench, or sprayed onto foliage. in the u.s., they are used on

some 200 milillion acres of cropland,d, on almostst allorn,n crops, as well as many fruits and vegetables. >> they are used in home and garden products, often at concentrations that are far higher than those you will find in the agricultural sector. >> millions of pounds of these insecticides arare used in urban and suburbanan areas. and in urn areas we're usually doing it to have the perfect rose or the nicest rhododendron or a lawn without any insect pests in it. >> manufacturers argue the pest-fighting power of neonics is indispensable to amererererer agriculture. without neonics, consumers would pay higher prices for f food, farm expopors woldld be ss c comtitiveveand the.s.s. economy y would suffer.

organochlorine insecticides, such as ddt and endosulfan, and initially these pesticides were viewed as a miracle chemistry. >> w we started usising more a d more of ththese as industrtrial agricululture took k hold in the fifties, sixties, and, really, talked about in "silent spring." using all these insecticides was really leading to what she felt was a collapse of biodiversity. we were killi t thehehehe of, uh, , of the food d chain. >> by thehe 1970s, regugulatorse rushing to get these organochlorine pesticides off theeeeeeeeeeeeeeeeeeeeeeeeeeeeee persistencnce in the envnvironmt anand their poible link with birth defects, cancers, eggshell thinning in birds, and other

problems. and early nineties, really people started to think, well, we need something that is more targeted. we need chemicals that are not so broadly toxic to everything. and thahat's really where neonicotinoids came frfro. the idea wawas that these chemicals, although highly toxic to insects, are less acutely toxic to mammals, they're less acutely toxito fish.hey also thought, what if we can target them m inside the plant? ? if wn target them inside the plant, this is going to be better, because the animals outside the plantntntntntntntntntntntntntntt >> theyecame pular becse hey we used asas systemic insecticide, so you cocould appy it to t the seed and d it wouldt be put in the grndnd and t plananwould take it as itit grows, eveventually giving the planant protectionon from pests.

>> they'rre found in the leave, the stems, the roots, and the pollen and the nectar. and nobody really thought about that weak link, which was toxic pollen, toxic nectar, and toxic for a long time in these crops. >> > neonicotinoids are nveve toxins affecting the nervss system of organisms. bayer r crp science says they are safe for honeybees. > honeybee health in north ameririca beg t to decle e many years before nnicotinoids s were in use. we've tested these products for many years, and in condition these products are safe, and h have ts o of studies tohow that. >> many scienststs whos researchs s not fued b bthe sticicidindustry challen t the safety oneonics,aying at even low velslsf exposure can affect the ability hononeybees to comommunicate and c can supps ththeir immune system, making tm momore susceptibible to virusesd varroaoa mites.

petiticideon theheees is manyfold. it affects reproduction. the navigational ability of the bees is impaired. they can't find their way home. if they can't finththeir wathths bk k to the hveve, theive gets depleted owoworker bees dd forager bees, , and the hive jut crashes after that. >> and it's not only honeybees that are affected. >> we're seeing broad-scale pollllinators, l like our bumblebees. perhaps 30% of our bumblebees arere in declinine, a quarter of them at risk of extinction in the near future. based in the united kingdom, looked into how neonicotinoids affect bumblebees. >> we wanted to know what would happen to a bumblebee nest that was next to a field of a had been treated as a seed dressing with a neonicotinoid. so we simply took bumblebee

nests and we either gave them healthy food for a fortnight or we gave them food that we'dio to mimic the exact concentrations that would be in the pollen or nectar they gathered from treated or [indistinct] crop. and then we put the nests outside. they then had to forage for themselves. landscape and bring back food we compared how well the nests did that were either treated or not treated. and the effects were really astonishing. we found that the control nests, t t t t t t t t t t t t t t t , the treated nest produced 85% fewer new queens than the healthy, the control nest. if that's happening with wild nests, which there's no reason hethat means that the following spring, there are going to be 85% fewer queen bees starting new nests, which you'd imagine could have huge knock-on long-term effects if that's happening every year.

>> and it's not only pollinators at risk. in june 2014, the task force on systemic pessticides, anan independentntp of scientists from 15 nations, found that neonics and the pesticide fipronil also harmed birds, amphibians, reptiles, as well as terrestrial and aquatic invertebrates. earthworms, vital foror soil productivityty, are esciciallyog behavior and sperm quality. jean-marc bonmatin of the national center for scientific research in france, waonone of tthe lead authorors of the gro's > [speaking f french] >> the task force says systemic

pesticide contamination is so widespread that the diversity and stability of the world's ecosystems is at risk. the task force based its findings on an analysis s of 800 peer-reviewed reportrts, the mot comprehensive reveview of the scientific literature on systemic pesticides to date. yeyr crop science said the task force ononly looks at w worst-casee scenarios, and ththat studies under realistic field conditions show that systemic pesticides do not harm honeybees, birds, or otr r wildlife. >> the main concern with neonics is ththat they have such a high toxicity to a broad range of invertebrates, terrestrial and aquatic. they are e extremely persistent and extremely mobile.

and you put those 3 conditions together and you're talking about reremoval of a large segmt of the invertebrate community. t th'rereccumulating in t soil. they'redrdrawn by hehedgow plants, by trs growing f faland, and so on and so essentiay anytng that's livingn farmnd is beinslowlyoisoned l the >>hehether thihat has come out is tha t they're e mu more watesoluble an eveveone was d to believe. is means that when ty get into theround wih water, they mo readi in across the environment. they are now found routinely in stream samples as well as well samples across ththe united states. swallows depend on insects as a food source. if insects are killed in their breeding ground, usually a body of water, birds are deprived of food.

>> the concentrations of the sufficient to kill the aquatic invertebrate life on which these birds depend. >> in canada, where on crops, dr. christy morrissey is also finding high levels of wetland contamination. she focuses her research in canada's breadbasket, the prairie pothole region of land is laced with potholes, small temporary ponds fed by snowmelt and rain. >> in 2013 we found up to 90% spng, even before the farmers were out seeding, had detectable levels of neonics in them. but our peak concentrations occurred after seeding, not surprising, particularly after were, you know, upwards of, uh,

3 parts per billion, which is well known to affect aquatic insects. >> with over 40% of the cropland in canada' with neonitinoids, the impact on aquatic insects and the animals that rely on them for food could be significant. dr. momorrissey's s study is the first to look into this issue in canada.fififififififififififif's trying to understand how neonicotinoids potentially get into wetlands and whether or not they affect aquatic invertebrates, which are the base of the food chain for all kinnds of other wildlife specie, and in particular, birds. so we're trying to link these 3 different things, um, from the--from the pesticide on the field to the wetlands to the bugs, and ultimately to the birds.s. we've found that neonicotinoids across the board have a range of toxicity for the different insect species. but for a certain group, and particularly the mayflies

and the midges, these speciesare to neonicotinoids. >> the chicks, the young birds, need that supply of insects. as do the, uh, the female birds, the hens, when they're laying their eggs. they need that high protein source. and there's some critical points in birds' life where insects are key and critical.l. and if the--t-the amount, the availability of r r r r r reduced, it has been shown that that affects reproduction. >> so we put nest boxes up in different sites, some that are uncontaminated, that have no pesticide use and in siteses tht intensive that hahave extensive use of neonicotinoids. >> morrissey is only a year and a half into a 4-year study, but is already starting to see some alarming effects.e e e e e e e s or got poor body condition at some of these agriculturally

intensive sites. so we know that therere is some lilink or some correlelation between n how wele birds s are doing in terms of health and their body condition and how many bugs or how abundant the bugs are. and that seems to relate well with the, uh, presence and levels of contamination in ththese ponds. >> there have been few studies to date on how neonics affect ocean life. this is an area of downs, and what he is learning is troubling. >> for example, imidacloprid can affect crab larvvae as low as 50 parts per quadrillion.n. itafaffects their tochondria at is level, thatt's mitochdrial poon. it c affect their muscles. if the mitochohondria a are damaged ine muscles, it c can cause paralys.

suppression in these crabs. meaning that they are much more sususceptible to bacterial infections and fungal infections when co-e-exposed with imidacloloprid. impact of imidacloprid on sea urchins. >> neonicotinoids cause dna damage in sea urchin sperm as low as 500 parts per trillion. it c causes developmental abnormalities as low as 5 parts per trillion. it means that they're a mutagen. um, it t meas there's a d direct threat to the rreproductivive fitness of the environments. if you have damage to sperm or if you have damage to eggs, the next gegeneration will not be as fit or might not come into e existence at all. um, so itit threatens steterili. >> the meso-american reef stretches 700 miles from the northern tip of mexico's yucatan

peninsula to honduras. it is ho t to a de d divsity found its s conminanatewith neonicononoids rgelely a rult of runf from agrultural elds. >> 8 yes ago, aoral ree gasmsm-wide surv was conducted to measu t the aununt of pesticides th could b b fndnd in leaea 22 coral reef ornismsms,anging from corarals to que c concho a a nuer off discoved d was at o outf alll the splples tt wewe clecteded 68%% of e sampmps that w collected were contaminated with imidadacloprid. 53% of f the sas wewe collected were c contamimid wiwith fipronil, which is anothr systemic pesticide. so the level of contamimination on n a coral reef, espececially thee second-d-largest barrier reef in the e e e

>> if neonicscs harm animals,s, what a about people?e? in human surrogates like rats and mice, neonics are linked to a wide range of disorders. and in human blood studies, they are linked to dna a damage and cell mutations. federal agencies like the environmental protection agency are really supposed to be, um, mamanaging these insecticides in a way that causes minimal harm to humans and other animals. >> startining in the 1990s, agency scientists were raising red flags about the mobility, the persistence, the toxicity of these e neonic products, inluluding thehe effects on pollinators and other wildlife. >> epa documents show agency scientists knew imidacloprid is highly toxic to songbirds,

aquatic invertebrates, and honeybees as early as 1993. yet epa allowed imidacloprid on the u.s. market a year later. after decades of expurure, the consesequences epa a scientistse warned about are now cononby thc pesticides. >> and unfortunately, these chchemicals are often, and i wod say most of f the time, rereased beforee there is s adequate arare harmful inin the environo. i thinknk neonicotinonoids are a prime exexample of thahat. >> epa assesses risk posed by pesticides prioioioioioioioioioy studies are typically conducted and paid for by pesticide manufacturers on their own product. epa says its decisions are informed by the best science available. inininininininininin studies by manufacturers, epa scientists review pesticide

studies from peer-reviewed scientific journals and data from a wide variety of sources when they are available. but come outfter a pesticicide is on thee market may not be evaluated by y epa until a a pesticide cos up for rereview, a process that canakake long a a15 yea.. farmers like drew stabler of laytonsville, maryland say that neonics can be used safely and are indispensable to their business. >> well, i think that any product t that's on t the markes been tested and proven to do a a job, and whave faith i in tt process. myself as a farmer, i'veveveveveveveveveveve i've been lucky enough to make a living doing what i like to do.nd we try y to use everything that's been tested and approved

and recommended at certain times for the benefit of the environment and the benefit of our pocketbook. you keep hearing about extra people in the world that need to bebe fed, so we c't back off on what our production ababilities arare. we feel we he to keep improving our production abilities. and some of these products will contntntntntntntnt that. >> the reasoson that we're worrd about neneonicotinoids specifically is s because e th'e being used at an unprecedented scale. >> essentially, it seems to me the agri-chemical industry has need ese products as an insurance against a pest outbreak in their crop. but actually, most of the t time the pests aren't there. so you're insuring against something which is never gonna happen. >> they have a real impact ononn natural enemies of the crop pests. we can cause secondary

pest outbreaks because these chemicals are so efficient at the parasites of the crop pests. perhrhaps 70% of the neonicotinoids usesed on soybeans in a seed treatment are not needed. there's nono pest tt just use them only when they were needed, we c could eliminae inseseicide use e over millionsf acres. >> many people would say we need pesticidededededededededede feed the growing world, the human population, and that maybe it's a necessary evil to sacrifice some wildlife along the way. fine. so you then look to see, to try to weigh up the damage that neonicotinoids seem to be doing against the benefit we get from them in terms of increased crop yield. and amazingly, it turns out there's virtually no evidence that they're actually effective. so there have been a whole sway

north america, come out in the last year or two where they've simply grown crops with and without seed dressing and find that they get exactly the same yield without the seed dressing as they do with it. >> some a actions arere being tn to curb the use of n neonics. in eeuropetthe european ununion banned 3 neonics s for a periof two years inin 2013. thehe ban tatargets neonics s used oplplas and cerealsls attractivive to popollinators. inin the uniteted states, the saving america's pollinators act was introduced in congress in 2013. earl blumenauer r r r r the sponsors of the bill. >> what we're attempting to do with this legegislation is blow a whistle. stotop moving f forwd with the products witithin the next 6 months that has this potential exceedidingly damagagg ffect anprohibit their use until we''re able to follow through on the r research to pre

ththat they're safe. > but congressional action is unlikely any time soon. in 2014, neonics were banned by the cities of eugene, oregon and spokane, washington on municipal property. the u.s. fish and wildlife servicce announceced pe refuges b by 2016. and the white house launched an initiative to strengthen federal action to improve pollinator research and ............ >> there are things that we can't control or not easily regulate, thihings like climatee change, eveven habitat loss are things that we can't control. but things like pesticides we >> well, nature is pretty good at fixining itself. but then tht assumes that you're going to remove the pressures that we're putting on it now. thin. we depd on bees to pollinate our crops, on worms

and other organisms that live in soil to keep the soil healthy and so on. if we wipe them all out, then ultimately, we'll wipe ourselves out. dedededededededed]

amy: from pacifica, this is democracy now!. accusers awaiting the who the accusers to show at least some piece of evidence that indicatatatatatatatatatata any crime during the period hat i was in the presidency. now, what is behind that is the