l b geee a hey doofof80 anan t trs f r rockene sssss. hearth ts i c co ou >> '80s djaarara quinn hoed and there were '80s icons behind evecorr. >> p page to self. this was the jacket that i wore dung my first televisis perfmance at enickodeon kikihoice awards inn 1986. >> welelt was more like 198989 cory, bu atleastthe jacket meanwhilebibiy idol gave his rebell yl bare chested. >> what you h ve toav in your dressing rorm now?< is there sometetngt t t y idol has got to have? there's quiuite a few this in the olddays. >>>> oh,h, well. >> what about this neweo of yours, mr.? >> if there a new sing, i don't know if they he singl anymore, the feit downad >> b grgrgughtheevento a ucngngtrutute daviboan s sred with us how bibi a fan he is. >> i did notnono y had that beautil. he's o audience network next month, but they can expepe to >> he's charmin has good onliners,, ande's not as rudedonald trump. there's another big reunion. >> look how awesome thi are. beyonce, kelly rowland and anyny

ppppininwe h h hthththththssddddddo ethiiiiii ththththththththththoorrorororo ititilililgive u u u anan f f f l l l lsssssssssssssssshhhhhhhh theeeeeeeeeeenwewewekeepepepepep pepepepepedodo a a aelelelel idadadadadadadadadadadadadadadaownnnsdddddddddddddtttee ilil ovovovfggg tuuuud dndndndn m m m m m mpmpmpmpmp r r r r r lllllllllllllllllllththththththth isszizizizizizizizizizizizi potststststsfrfrzizizizizizitttttttttududududrlrlrlrlt dddtyyyyniaiaiaiaiaiaiaiaia ddddddd 2222222tttttrtrtrtrt s s s s s s s prprpr l l l l lw ununununununun a a arr eewspppts s s ffffeeeee sosososoe e e e rounun20tttee thosos ddeee e wiwiwiwiwiwiwiwiwiwiwiwid.d.d.d.d.d.d.d. 18sslll otototmimimimimifififiooooeeevevevevesse 777777777 .... attttetetetete a a a ututhehehehe toodtttiinnnn ararartiti hhhh ovovovovovovds artititiooooo u u u u u u uhehe ddcococo nn yoooooaaseseseeeeee sisisig t t the n n n n ndd ssssssssshhhiit sii t t t t thththththrerererereysysysysysysysysyscocococout o o o o o o o o opupuininin tt llllllalal m mntaiaiai i i t t t t t t t r w w w t t t t tyyyyyyyyooooooaaaaayoyo w w w w w w wpep

the e ananer questions-- now that a leading candidate says- he doesn't want ththjob. and: e emergencnc- that forced d e coast guard neneing a rescue themselves! ! but first here's mike in the friday mning ows day.z. rereararars are hopopg a new -- in e future.. ,,,,,,,,,,, you weren't prepared for whe the sun ca up this morning whatou saw. . tragedi$ theheouth as people retutued to pick up what's'seft of eir lilis afafr this week's outbreakakf vere weather. is is s fo north rolina...whe several 20-thovsand pe areithout power totoght. 3 3 opleleave been killelein this outbrbrk...the more killedn virginin from stormsms at blethrough yesterery. members of the coast guard found themsees rescsing their own-after a bobo capsi thast guard responded to a ing boat that ran aground in new rk-- when it tipped overer early this morning. ne on the ast guard bo-- or theishing boaoa- were h ht. the drama susuounding who will be the next supreme court justice-- took anoer tn today. da goverr brian n ndovalal ld t t white house totay 's not interesested the j. ne broke yterdrd tt the

. >>> anan plenty to keep you entertained during thiz frozen valentine's day weekend. "early today" starts right now. >>> good to be with you. bracing for dangerously cold temperatures this valentine's day weekend. a polar vortex bringing bone chilling weather all the way down the florida. and whiteout conditions along sections of the new york thru way and in scranton nearby homes power lines all coated in ice. i can't even remember we've dropped this low in the northeast. so, i don't even know what that feels like. >> and you're not going to like it either. it's going to be a really, really cold weekend across m!ny spots. we are looking at some dampgngerous cold. this is the leading edge of the arctic air. 19 below for the wind chill in that would stay up in northern minnesota. it wl sweep down the south and east and all the places under wind chill alerts. that means how it feels will drop to 35 below zero. that's dangerous cold. you need to layer up. and it looks like areas of the southwest will be in the 80s this weekend. so, it's not everywhere. >> thank you very m

rampart high school held it ananal bald for cks event today. their chlenge? to raise 50- ththnd dollars. krdo newschanne13's's dadadaolina shows ususow they're maki it happ... thgym isis hundrereref ststents a avxious ... nats: say goodbye to theihairnats - clippers lititit kids. "@ys. . s! shavg g all off. 15::49 it's ery shave. a fefeyeyes o, my mom, w wgot t ared shehead to suppopo her a my .pw.w.w.59:57 our high school is doing somethinb gger than just what normig uld do. . theseskids are ising money ...working re. 15:0 - 12 2 2 allowss to u uteten a sile,cause. actutu unu ia leause. because e noatw yoyo are,cnll affec , d the sooner w wcacafindnd can stststosing loved event ist ju abo raisisg moy. people are here to indescribable, its surviviv. he impact this level l support can :15:5:hat will give hope to people who need it most. . losing their locks. in colorado spngs, dana molili, krdo newswsannel l the high scscol holdsds secondndndnd for rhe e st high schcol holds secondndlace for the most money raised for the society. a coup in oregonononon openen

for live`effictions 24 hoa y, go to our w w channenenektv v v m anan click t t. happeng now -- police ofn do rings are e e ng d d d fofoowing recece ms shshtis.s. rding tototo partners the gazeze52 offffers le foror lasasasar. their r r gnation letters blame violence againsw forcement. nt pice academy recrui wiwiwiikely hehe fill some of those sitions. most of the ofcers l lt after wowog the for less three mohs a a aa u-u-c-s cecewawawalled i ithe shoong aa planned parenthoodclic. . five officerwere injurede okg ahead to the m momial rvice for a fallen deputy. you'll recall park county deputy nate carrigqn n shot andndillelewhile e rvrvg a`a`` evon nono lt w ek. two othedeputies werererot and inind fore killili the suspect. 've lelenethmemoriri for carriwiwill hbpp aund 11 on the morng g ar4tvada's f f ble chapel. e socoty sheri's ofce i eppipin toov forservicicink unun the mem weststinon topf to 2ininatalert...mingng 11 newshik) rng... wh need now abou day's h` fife danger..to prevent ather grass like this one.but rst... her violt g gttackck. timin pararot cacac

he's gone now or going to be gone, retiring, anan so whwh kind of void does that leave and how do you fill that and what steps have you taken already to make sure that there's a competent person in there to do what dick did? >> mayay brown: sure, mr. gagas is very knowledgeable. >> ron: we had him on the show too. >> mayor brown: yeah, he has either a photographic memory or visual memory. some of the things he pullsup with differere questions i haveve for him, he's been very invaluable. as was dick in his departure. some folks might have thought, there was concern there, the two top positions in cedar falls, might have concerns with that void, but i looked at it differently as really an opportunity for two new leaders to come in without, you know, losing a lot of that historical information that ron has to further cedar falls the way i wanted to have it furthered bo both of ous talked about public safety -- of us talked about public safety, key issue for both communities, perhaps maybe

w wrere t t t t t thehehehehehehehe anan f fw w w t t t t t arerererebebererererere w w w w w e e engnghank youououououououou for jojoinin u u ueseseseseses : : : m m llllll m m m m m f fstststststononon,,onightggg toooooooooooooootototototototosesesehtht brbrg g t t t t p pssssakakak s s satatatatkekekekekekeke kaylyl f f f morororororor weeeeeeeeckititiefeoeoeoeoeoeoeo b b b b b b b b b shamambrbrbrbrbrbrbr i ihassor e'e'e'e' seeeeeeee t t t t tolol nnelel i i f f forththththththththththththth ggppe,e,e,e,e, f f f f f wewewewewewewewe h h htitititior ligig owowowowowowowowowowowowow innnnn a aa,a, i i i ihohohohohohohoho stststwawawa m meee m mtititiiththk k k k k k s o o o o o o o shohohohohohoho ititbut t t t t t t t m mshshsh enenalal outhehehehehehehehehehe timemememememe,,,,,, w w s s s s stitititititi t t t tololol i iititititititititit i i i i i i stststststststststst f f f f fhehehe........ bebebeenen a a a a a:0:0:0:0:0:0:0:0:0:0:0 pusus ototototototot l ltinnnnnnnn 2 t t trararerereeeee i i i i i i ixpxpttotototototo s swww i i i saiaiai'l'l'l'l'l'l'l'l'l'l'l eeenowwww i i i m m

e coannuct anan vitain0-for s bscribers ter nc june ing eivay, 20li mb ifs been opion nce 2011 apsi ys iig crs has the0 day fralperiod thaslowly been attracting mor users.and keeping them. it's n one ththeyve .. fi an 's 5ar d thrae lls rf ht li. sa, otpray wme..is my tr." n carorot yey was it comes jannod w album rele wepleafauyheum helout. th reough kealhide cims ar true ofalse. th'r ierecen are bla nand gibson have the dewh in this moera'money. amer cession a survey finaiarsfound that aentageof fancialad bie thathais year eitheroderat mana may agenniff portly thaus log in ng dpl"smasherds uge in prenay y, wll s paly clo sk afternoon.atures tald, reng the 560dswie eezysustwiultwee10 wi stre sh in in e cerad nortrn tas. hellin tort roug anintoenhe y will trs hs tt t 6070igwnfoca teesilstl ve . et mm miis iov at do neradi 1.5 and24 wiou sar trfic. 's ack a raff ibn mm ke i ert do ws 1.5 nd24 thsar afc. here a raff a do springre s aew iey sterrning he deils a laced e colo. d moren de meowreinked aveir eshy lo. it:--,da ..anclemmas esassleepi r mog. moranlicar was stolen.ahe ma possf man

anmpyeshotead afr ening re an hihiown co-wos..wi who n hoho he hehuand ho. 33 anan. apl wohelplp the e ....but t fore you take sides wre breaking wnwnwn exactly wt is meaerriricyfox21 news at 10 p-m startnow. 3& mawhfatally shsh corado sheriff's dutyt anwoded twototrs.. mayay haled before.. uittedf kig a man duri a chesse mo than twdeagag fox21's bie burke jos us with this s informatn at 10 tonight le in the neneroom..abbie?3 marwiwih waund no ty of seseve-degrde baba in 19 in fort cns overhehootgndedeh is 24ear old ighbob ighb..e cololodo newspaper rerted at the me thatrosesetorsd ththo were auiui inside s neighb's h hse..er a c css game..and wih le t ta revovner. . wiwih reportedly std thth the man provoked h h to come outsi.. d then l lged fohin. wirth ot h twice in the chest.jurors td the` wspaper they were confli the verdict. 3 wirth was killed in sh with park countyheff deputies wednesd..when the tried to sim an evicti noticecocoor nate kerrigan..lsdiedn the dent.reportg live in th wsroom.. fox1 news. 3 this tragedy has the el paso - county sheff's offe lookokg

but our need for public safety d our need for privavavare crashingnto ch o oer, anan we've goto sort that out as a congress should have a bigger le in this debate, b b, scsct, the c urt se imoving% rward. gogole and facebooooare expected to file legal rsrsn suppt apple >> pellele jeff pegues for uss nigh jeff, ank you. tornadoes in severer states sterday killed at least four people, including three waverly, virginia, where we fi ch reid tonight.t. >> man, it'sn exe^rience, man. you got to experience it to talk ababt it. >>>>eporter: vince donond was abouto s dn right he to wawah tv w wn the totoado d into his mobobe home, riff the roof anthe wall.. do you feel lucky tototoaliv >> i'm not lucky. i'blesd.d. b>> reportrr: b b theheornadodo toto h nbor's mobile he i ioundndndndanan i i sasag g"ross a highwhwhw two-o-ar-old, his father, and d otr n n ed. thr bodiesnd otherebriew re found 300 yds away. mehoho t ther surved with seous injuju. in nearby appopottox, rginia, buildings were damaged after funnel cloud left ananighthtile path of destructio leaststhree tornadodo were rerereed inor

november we to y y a u-s magistrate commended thththse b throwo o, anan thcisions s l. this c ces as pueblo police are ininto keke hellinbmbmend's i-one&r answers.s. inveigators are having a difficult time gettttg thth injormation they need fm m cas' ipho. he was her last known ntact. veigatorsr have tried to & break into t phone fofo monthsh#busaapplplmakeitit ry difcult at's alsls beenenef case for the f-b-i in ththsan bebeardino shootingng pueblo p-d says they'r'rwaiting to seeeeowowow plays out... bebebe movov forward. but schelling's mothth is disaointed and thehe are other tions. ante is alive, ey c c use thehe cot to and get the password from him and i doesn't complye can be held in ntempt." schelling' ther was hopi lawst uld ad to anere2in t t tse we talald tha a cal prive veveigator o says protected cell phes is fficult. 807 if there are tomany attempts... theres a 4 or 6 git passcode... tha encryptiti dedece automatitilly locks down so 's extremelyly fficululfor lala enforcememt to get in 824 the p.i. also sayst's a matter rights.. we'low you w, cing at five.

d still mo anan third of us do not get enough shut-ey nd that't'a problem. he why telelelele youoget t the re risk you ve for o -- diaiates -- heart diseasas-- anananntal illness. totoake suru u get enough ut -- try to stick to a schedule. go to bed and wake up at the same times each day... includyng enenen keep your room dark --and get rid of eltronics.. yes put e phone away. and duding the day -- try to exercise. if y do all that and still yououo all that and still can't get enough rest -- goo your docr. which do kids ke best, running around at recesspor math class? a new study suggggts they coululget the beststf bo wods in the assroom. sotimes kids haveve hard time sittttg still inschoho. ahd new research suests with a different teaching method, they may not have to. researchers in the netherlands tested two different sttegies i second and third graders. phalff the students sat i thr chairs, , usual.. and ththth ototr half had phically actcte lesson with mental and physical challenges combined. these spiced up lesson plans spelling. the findin... jumping

degrrysihappenlingt mo to f set ans te lhaitls st " peonro to m oine 'hsomes br yowho are to cir bra ks, anan to d.ts." i'chhew.yo t ap thiqthe9trclefesar wh kwh millpafl wme b erau whats i. >> >> ne!>>nk-- y k r e m ster f anare.es, stte "america's got " ani mys youck ord c.in t nte o nd akro y did maansi mro i ha

med with an assat rifle anan an`automomhh pistol cedric f fd iururur4 coworkerand killed epople. thories ndndhd$& kill h na dcececes onofd'fitargets.e trietorjrjhicle.e.e e ot bqt t ssss "i"i"ild have bebeisir viviim thaed bececect t reighthe//you duckckckckt in "id the sotin fd wa edith a prototot order tan by his ex rl. auaues b bieie tt inineveral prfant women r%. man n`juju f fhs pr wshe avel t hondas. positive for zika virusat 9 wks she miscarrisays t t t a 9 irird pregnt mememeth thehehea a a s in the . whatatat i ith mewhw(werenfecd wiwiwithfifit tr, 2 2 d spontaneou mimi momo s s slly,f those ca t won hathy bababa, o had miriageseseses o o i`at t t@ pregnancie one haa born with mimiocochaha. e all hed ofofudging. . llltoday, dold tru t wateteinkiki i iteadad 37 iruru ummo r's 2013 stste e e hehenion reseseseswhwh pauso wa a a a of watete e twhaadjaja ap e e eotheheer since e e hththtbaba today, t tmp picked up an theris no onwho is better prepared t' prove am wi t t s s s serer t ititeeds bh h omd gpnd thrl donond d d p p t's too early y whhehe$dsi cpie fniatat there is a

anan . i'm ?? " the latest now, about the susuen resignatioi/of an entire high school girl's basketball coaching staff.@ itit hapapning at pine c cek high s soooo jususas the thgirls' head coh nny van-doesn't t ink what's happened in the department i fair@ro the stutents or e other aches. he ss he's thankfufor the time he spent aching. . district 20 would not gi any details ubout e sudddd resignations. the he coach emailed us th statent, saying quote-- "//it's ve unfortunate timing but 's what e hool felt best to do it t e mont. as faf athe rumors about w w andeople attackininmy character, #i am extremely d of the wo i i i in e la c cpl monthshsith the kiki a a that something none can n keke awaw no er how h tr f athploff f me ysketbalal coacng sff wl be filli in. w thisorora cal airport is celebrating its grand re-opening. eat lakes airlinesess bringing back connecting flights fr pueblblto denver. cutting ceremony to kick off its service with the rline. thealal opepep%a restaura and modethe termin

anan... tmaer counonoo.. thnothck c a h om 2 e cowl ysouin ei treagcyr t de mame ohnlw..peonte thea oher br ers e y coon reportg li ifro, k n t kes,! e. apt kesionaloviding anatpeservar yo w aac hes ee of focarig au di genhere t's jak nna se ] we h do. d tseu la 1, thcago i"tng" obu. me dnt?yo,0, d 'dr o t.el sa wi mfu 1s,ry he retil ilenome ya a col i'em assttste oo e fuls puy, a orthwi cfaes l ootou hthk yr lovoewero n d en f e y ot aat state u i a b l ri, all your joelamsisttail c ur s ike y tid er alght,d haveyothas wl. omle inw i'a. m ork nirarloifch yrsd daerwho'anrd le as i tas tooyangirlsment right,they'racge no uth,0il dethoile fi

why selling your old smart phone anan making a few extra bucks could leave you vulnerable to hackers. >>> video captures a crook letting him slip through his fingers. police are looking for this butabling b bglar. >>> if you're looking for holiday weekend plans, miami has it. breaking news out o lowe's presents: how to plan for the future. happy valentine's day. happy birthday. sorry i forgot our anniversary. happy mother's day. nonoget this 1.5-pint orchid for only $9.98, . actor's jennifer lawrence made unwanted headlines when hackers leaked their personal @nfo onto the internet. your information could fall into the wrong hands easily and you could become a hacker's next target. the internet makes it easier to sell your smart phone. the transaction could leave your vulnerable. he posted his ippne 4 on ebay being sure to wipe it clean. >> i did a full factory reset. he accessed my password and information. >> reporter: the buyer unhappy with the purchase changed the pass word on his new iphone and apple laptop. >> within a few days everything i had was just in lock mode. i can't get

foa uy soy s anan nanow d ra , nisolclhear cl fay/d,d1,-12,20 ionwo hour lall ation, force bairsesssentrson nrlan .m. ca ay. t aasg reie n thscll otofcr atv niit lyng ghons. wre bow zero fomany. night t, we' ly a lithaftern is, l a e'el fay andtet os coer o, ly thinemtus stue. noamit c cr hiof roadell. icy ror fficgooucocloura i hover 1ea art. iut co stco e.pe 11inpo ro cdis ra ply wibola ak.iv sinin tathagitisn thto thasn e primsend roadret ti at nso once r d llearahtin'sleerwhowgetot tonds onim keopdadis rt tur. veck t no un,tndret re..wh--yoin thjor esdad n voon, and le arsu n enile an fm at new .. lice n ce sas csie oobm. igssle lnesan po ow60 dyndhandrownhersmeveouo shisllfotain-d..nuern 3885nerecrst. ls sh..itinatments,cheltoin wasord ngown morning.up'lta rne octs yo goby l ll cang fbs s th m os thr e i aonpsavtaha glesttn m th a " w s> tornadoedohe >>e pl. crash like >>anxp a jetlimalia. rmusilpager. wt bstor a tsa ie,t t pia gw e.ewpsreg t w e-tohepca ur uag nde.uson renntract tou onneiep inst hef anela r. dieaunne a t

.>> itin t onurtu h aur unngr und st ia.rfncebs anan ing er >> b we arts t'alin >> tigstn muc fa njunderbaprt d leslthso>> avery yr h s go. feyeon tgoth t >>oumo iluen kthshoppi thfaly. eshrares wa m rstwmy er whiincledonf the year. >>s tmyev sle arlo. so s, e xt >> y wrote a ng hoou ur til uger? ve h tideshmit e. ndohorjo wl- teit sirse avyod chce tme adyet. >>t d t me heretnie h, d e'goayist lki f >>iol el. ron'sacti at eminal mngurina brk hehow. h i m'reok fo >>sog in emi a meair. sin t l a ae grmy comg >> tri m s eg s c inamashir e guee.dothk j berig ghnawogrby w, asbl g a e t h lite he >>nd wgoehd sces ofwestefans muc de > g a w cpe toft par. dunk cheed ow t anjamerdenalou dog dole dut iot ethngut ams. e gr whaugis ees. norm uat and gwevcoume o and see right e? thatshelt's real signurthere.akdid y check qwitch whn acly swaed s forollerkateut tu ay ubki tll,ic w ld w actlly and. d ta a big ri d payf eer y en was over. ro xe stee ee anjozee lk tr outhe ok h hwas actulyutf e blir'rliouno, wantdoorbla, , think ike e st mightdot . instead of stresout.neon neface ocoverglantaneyd o it okenveir

anan..ththe'e'whwhwhhoho dvr. plus tons ofofn demand optio you can watch whatever,enever yes s d? why dodoou guys keke sinthat? it's theirst rule of improv. by saying "yes and," we accept the rereity created byururomedy partrtrs, papa.. yes, r rht, i know. go you? feel like e hollywood sisi confrontation with police in northern colorob early this morning ound 1-30 in the mornqng lice were callll out to check on a s spicious vevecle@in evevs. it's about t tours north of spngs.two meran from thehscene, one fofosevevel hours, before exchging gunfire th pe. the d-a's office and outsi lice a ancies are now investigating. joe tymkowowh weld countntnt erifi spokesperson we hope thatonon that none is injurururthat i iprimimy, on the othehaha there's times died, and the officers involved haven't been releasese today, apple a aed a j jge to vacate ader to helel thfbf acss encrypted data. that data is o oan iphone lololog to one of e sasa bernararnr shooters. the company acacsed the federal governmemene of seeking quote "dangerous power" ugh the cour. the fbi says it needs the tech mpany's h

thofwo onex d toda er 1 d anan e >>en kih eneswn a inan seorci ag l outi rogi raa pdci asela ti t.llthagde rorstd ld egnae ouerd llin alnipocclasc eslito bn ve an n rimideicannd ama. tete wsthbienou o neve o. orcong aneheo'in ow ak toofma >>> another dose of winter weather is moving in to our state today. >> dry 5 is on the roads, elizabeth gardner is keeping an eye on the radar, she will tell you who will see the most impact from the storm. >> a must see music video, this okay go video will blow your mind, how they were able to achieve zero gravity. those stories and more coming up on fox 50 at 7:00. >>> a big valentines day ahead for an indiana couple. >> patrick sullivan wanted to make this valentines day special and bought a billboard with a sweet message for his wonderful wife patricia and she was left speechless. >> i started gasping and crying. totally lost out. it was really exciting, that's what i wanted was to surprise her and let her know how sperm she is and let her know, these 27 years have been great for me. >> what a beautiful love story. >> patricia usually asks for a modes

anan by his ground game. touching every county in the state. iowa. compare that to the 39 stops even though he's still leading in national polls, trump has added a different title to his golden resume. loser. the website loser.com redirecting users to the donald's wikikedia age. anan now one of trump's old tweets coming back to haunt him. "no one rememrs who came in second. walter hagen." >> beautiful. tremendodo. >> reporter: tonight in milford, new hampshire trump refusing to back down. >> if we are attacked, somebody attacks us, wouldn't you rather have trump as president if you're attacked? we'll beatt the [ bleep ] out of them. >> new hampshire counts. >> reporter: but here in new hampshire trump supporters are still confident the donond will prevail.l. >> he's going t t make america great again! >> reporter: despite his third-place finish the biggest surprise and perhaps biggest score of the night was marco rubio. >> they told me i needed to wait my turn. that i needed to wait in line. >> reporter: his late surge giving him the green light to c

>>>>lowing people out the back, anan thought heasasoing ot me. >> repepter: 14 bre gounded and 3 killed. 24 minutes of terror onon c cing an end storms t building tang firase ente. >> the only reason he e oped shooti is s because oicer% stopped the shooteter. >>>>eporter: cededc ford hadbd 20-yeyeye\e criminal history felolocharged with lary, , ant ancarrrrng ncealed apon. inourt docen his ex-girrid asng foprotti ord sangngs an alcolic, vlent depresd. itity beliefs in deerate need of dical an hohogicalp. lile served that restininordedeto ford at e cel shortly before the s soting. nnis bton jr. shotht ababthree dren aheas shed to th hospal >> i dididt wa to o lethth. sneady ave didn want toieie >> reporter: tonight heartbreakthis small communititfor the dede.. nee bebeamin was0, brian sadowski 34 and ved rock musicnd jojouauaigbee, 31, a ung father who loved hile boy. >> he didn't d derve deseed this. >>>>orter: tonight p several peopleleemai@ spitalized including one in critil coitionn pliceay f f fwas memewith an asasult rifle anana handgun.nbc`news hasrned ose weapopo were boht by ex-

anan one very smallll and simple way to make a big impact on monthly retirement income. we'll tell you how, next its sleek design... is mold-breaking. its intelligent drive systems... paradigm-shifting. its technology-filled cabin...jaw-dropping. its performance...breathtaking. its self-parking...and self-braking...show-stopping. mercedes-benz resets the bar for the luxury suv. starting at $38,950. jake reese, "day to feel alive" jake reese, "day to feel alive" >>> for more on our show and our guests, go to our website. follow us on twitter. >>> here are the stories coming up that may impact your money this ek. on mondaye'll get a look at the housing market with pending home sales for january. on tuesday, we'll see if the auto industry is driving up sales with the latest monthly report. >>> and it's super tuesday, when 12 states in one territory will hold primaries or caucuses. >>> on thursday we'll get an idea how the services sector is doing with the nonmanufacturing index for february. >>> and the big number everyone will be watching on friday. the employment report.

stranger comes to the victim is certain it was anan angel who appeared in saved his life. the amazing story of a rescue that even first responders cannot explain angels among us an exclusive out here.est six different thing musicians from the cleveland area were awarded to instruments of their submitting essays as to why they need him. 437 another traffic every every eight minutes. struggle. we do have some spots and but come from the dishonest press.s. >> assault when conference combined with that jeb bush is marco rubio and ted cruz adjusting for position is the best alternative to trump. you can't bht figure going to makem america great he's have to explaina you're going to do it. het. has explained that he has a relatively high floor of support that he alsoy has the ceiling. john kasich is not making any campaign stops there focusing his efforts on instead crucial southern state fromin the blue side of the aisle she is hoping that she is hoping that she can push through south carolina and super tuesday. >> isd bernie sanders is showing no signs of slowing down.g the wi

anan mitee . s harz adthngbomoow h h te e - d . cotag rre an. g he perld - annel 13sports fit's r nas ie.. ieg ton this wk happn ayhtbak ro o e ornd ed at dith .wou y at oshis gethri thatnutt anat's is wee m's tt ks cain t exri ofcorado hyo tere ata.m. no dr u.assterwayou strongrnoo kiorbling acpl ing i nt fi danhabendl coinuebe con ro wl lweinrow berein lo w re , end dfrolwo is im kmetonierhin,la-walne and c aser c a td now,move y ch and ause ] >>im:elco t theow m mm the hos ank u for tcngthyofocoming very nice.at's ce.somethe audie w doing cheerleaich i appr yoere th dyou. oh, m glaehereesalest s lt ght. stnit, t oou h knlastig t uhiab pp. it raid. teramwn ontos. meitot omy whh whentains inl.a. weon kn what o wh rsves. i't a jo. wentone t sh. t of a i pneief r g ,'ve b t prly fivtime t i nely s much mph to ll mere e parfyin thatws ehingreas been .i stiem allhe lyr toheueyewis s i t find anyre thce. so d get dnutesateveryon the- erybody's amess. inudg. wee ti le jt thrghne om ad m froad." pe a panti as asfe'd cgh in the of a hurrind rrowlyesca

they're chopping off hean sya anan all over the middle east. is is doing a number and plplty of otherseyis a dow. analknkn i ith when th starhoppinf w w vebebey y firm weavavbe vy st.av b very vigilant. i heh h h statement and we have tbe veryy strong. n n iginesese peoplp th chop off@eads of christiund pnty of other peopnd t dy doo didoutinean pplen b b sell throem thve it f aalhour anput u und evybs dead when tyatk ou uwar arar ho sosoone's haed all our technology. technology. say,ave u enllheaming nolo in geico's mobile app? mobilelapp? look. electrtric i icards, emergency roadside servicece i can even submit a alaim.m. wow... yep, geiei's mobilappworks like a charm ge ex gand wholollore soti ese kltral ha bs nal moturen get intot qur. knoshe'inint, iinan.. el fifrence kag miothe worlrls anpersra thocapsusus actited by movt, th relseseurst freshnall day. moonsense. prti tep min deee. et down. too late, we're abou take off.esssve ft.they'rw idels.d yore cg the... u u ali gold statususus cicisinus-mali gs. ssolvefast to ueashsh strength medine

uonne trn n r d t rs ro ss ay onbuer ra h atneve ste oflioc thdeoutast nlake tle a a spylistv anan-d.tc w d el m etatac y esof mon , [ hernent lemee,tpris to 4f et lyonips o ns rna e tquta f tc tigd inor. lehaeron tbronthhaght workg the planto alon t weeo ro oghwa ins otd westb la awestu , st ryha stogcahi throst d u a80 yokn the c lksre'vreg ne ag leeaba. haco te ontrol ordi it'sdi pes act. sh t people fg spd you mberprd neerwhy a lot coion trie er g ntar ate abtos e at anus cnahealwet u at outow 'r ysupebo look athis y, aoncos h ahe weyi ui'caow hwmeinmo teates mnl clugthmobeerhe lodo wtyd teat gromndaythe ri aftern s the 50and 60s through e restf e week.with noems adh dahoulbee brk fromold anl see meeltigoin pce. es btoday'. . ut ticothly to draff an coxt uing now.etne doth morhe broar, dourchedsupeshrtoogs. hee ginposi gina with ers...teinyou? they their rninzen pe outse so tthchthey hunrglalvesbrs whe in. emt at d well wer gdot toll in poba g a o i ck to et..et h irt.. o coini'gi pel, the uperl wnenverris a mthe --st othivic cat 1 oning..the denv a ch. kinge wlerol thnvnc s wl ngfi

anmpyeshotead afr ening re an hihiown co-wos..wi who n hoho he hehuand ho. 33 anan. apl wohelplp the e ....but t fore you take sides wre breaking wnwnwn exactly wt is meaerriricyfox21 news at 10 p-m startnow. 3& mawhfatally shsh corado sheriff's dutyt anwoded twototrs.. mayay haled before..

inow, can mtaken y owy stor yand,noou kw, t byimhe t ae wepdd u t allhe pe wopledoure mntoiy lt d anan i cak speallf a tr inamazg afn-ricariame.cans t bu l myife is so dseiver usbecahee t wre berelack lepeop, th were werelepeop hi icspanpl peooe whre pouo int anme gd mavee a cehanct afeli. i'm rfoever agrl.tefu ry>> k: stalt' thaats wht''s is ab out. >>t iyeall .does ry>> k: stalmi comnessioi ek weally, awaysea ple.sur ywillomou cbae ck. >> ou i wold l omeud. ckba. k >>alrystou: y a aresa prri ff e th show. l we yoveou o.to with tanhe micabr oveevi >> he mic lle: weachweeek rt pawiner hith ccodeo.om tin brg u yori stoboes aaut c ausend gi .ving dkin a ofdagoeel-sod .toryt whek tn rde chiauo cwise q ak thoo a leg man's es pr t ojecriis bg ngins homeo pe leop r whoy eall needmo.them e >> ep rteor r:eggrno khaws tlo on pee onrs t'sshraan cru t ly cobe smeeome onseelmureasa s byinourcmbll ilyegalipeum ma alteris 'shere catedl she ters for peeopln i .need oo>> lhak wthe ty'reak ting and in dog with .it uncommerle otkima.ng >> ep rteor r:sebaind ca foliiarnhe tom heel ssusho oj pr cectsterea

. >> there was aouple of phographs anan appearance by him on this iyour lifnd he ca out withe script and a linehass h hut your oppition is either personal baggage or the personification ofvil, hitler. onnd the ia being acal-rt, deeshiabou imadee e m@.trustt u dnotovovhe, feel awf st o o lif my wi will walkut on me and i will e up drinkine myself stutupid -- >> i it dinot feel dissimilar fromhe characters we are trying to portray. he knew who i was and we are had done ae e re put on boatith va waterer the story o of jwens. we looked at this and a l l of it hado dith it b internatlly finance andt ulven gatit loooososo at e dd as tsame w and i couldfefehe d d differenc a i >> youet a chancto be part lk away? >> there is only fast and s s. >> h he is the rundown of thee top fif movieiein the usa >> h@is goi to hang in.n.n. nhing c could prepare me for e trh has >> n nobsa thi we eveineyey did made my bodyndestructie. >> i finished higscol just a a a 9/11 and along with some high school buddies , i signed up p r the a2my. / i am very y oud to have served my country and i'd be with my unit

thits...ea lyillie e wesni ..s compy is l atim tr ta anan... kiroght. 3hi t cty r od oat yngoy girl werl dren's at sti3s ttarfrano.s re strbyhe rtdi ndmse ke he wow y um oh yiitcail avenolto ope satithpr te gensr . the l ab3 s.. 's 3 theor patting - ma b..bidowoh ylph ce 0-arthliquin edliauieharestrgr people.. (ewhd r)hu olrts w ri. begig s n ctofin amicnd frelavele he was ia re.. there ey he.'s ret amd dcored in africauntr t rdan thias trit .3 brth s. ecded. o danaces ckth onteaamerght no. e are veradaged buthere.noib rehoutpower.an old e e wind and rain reck further ut l plus.. aear ho a t cidropng antly.rinow steln 5 an ali tdetion poing urid s sug dea bopleie irne ats. hower... tal intwjoass eredrae a'rne l g-s alreadg w t procsiac e de c yis poto e t,nef.ru stathsscef un tfithryntna ge y ourowe, tting th cailor thest men t of her,ormer fl ebush. bintothisy,oiwa, beieambyurep hiheag ihi h dtt nt prth s ucy clai scraen idnt in heel she senor sonioumy f ca t satury enausus revallin be- pes hets ticte uilar. in reno, s tes or 10. r tthed 3 pl.

well, ken has developed anan tested a product called omega xl. now, we've all heard about the benefits of a daily dose of fish oil, but they tell me that omega xl takes a giant leap forward towards maintaining good health. now, we're also gonna speak to dr. sharon mcquillan, a board-certified in family practice, specializing in anti-aging and preventative medicines.

anane stpl.po aaninthem483 hrt ylodo atn at had a ed 96 ctim 20-1 thiar w $ro b ea t s sof gn l edte p hod.. anthats en authooffialsaey dope tse t sothg r ops inhelaarou. ati av oin ari rsheinmo ome "sa tllcovecaay. cee u'r asto o lile tero esx st 3d he even

s thththththngngngltltlili.... oducucucucucucwww multltltltltltltltltffffffffhahae e e ininand d d anan m m m m myour w w wngngngngngng hahafefefegg h h h heeluluededederer eeeeeeee, , t hehehe isssss d de e rrr t t t tn.n.n.llllllosinininininininininininininin in n n n owllllllll 5 5 5 5 5 pantntntntntntnt t tss w w wwoststteteheyyyyadininrsrsrsrsrsrsrsrs o o o o o o o c c cacacatatatatatatatatat vovovovovovoorororororor t t t c c c ctete , t t tererer t t t t y y y y y y y y y y y y y y y y y y y y y y y artersrsrsrsheheers,s, t tyy llllomom frere agagag w wn ththewewew bebebe i i ichchchch ytononononon,, joioioioi tataa,a, m mtththththth ititit u u u u h h h h h h h h h h h h h h h h h ararououou t t t g g g thehehesososososooioioioioi >>>>>>>>>>>>>>eeeee t taytototototoanddd ffeaeaeaea b b b b b b bacacac rrrrithhhhrororontnt d d dnaisisg g lolololololololololo excicicici,,,,,anananatatatatatoo gegegegeeeeeee s s sededed anananananananananananononheheheimimim rararaastt y y y y y y w w w w w fofo y y r r r r r r r rhhhmomomomo intntntnt 5 5.goodod t tun,,,,,,,,,,wawaalal t t d d d d

e drape on thehe dress gs outx anan t t t hip brings in. this wasomething that lightened h up overala a i though i general i ust t tng e' sotunning it'ool she pull something new off. she'seen tot so anyy of these@ award sws and it was nice. like th. (( nexex sofia vergar. >> she often wea dress tha look similar tot the one she wore before. >> it' her stutu look. she knows h to pull it off. she h suchtatement earringson. >> i led the orinin. i thohght welel i lets the strue otheeress s sndut t she's soo - this@ imarc pthey a kno forrnat cnstrtrtion or embellishment. buty is anoth b trend at pops up othe carpete red ey. pink. people are doing i in kind of -- >> it's noooo lk for me. >> it can make youryes l lk tired. i'm curious if people a homee -- do thehehe lik this look r not like this look? >> we lov erybody. >> led this one.e. >> thankyou. oscar fashionsren't thehe onlnl thingg trendi, unrtately, is the flu. howwo yoyo know you have it or cold or allergies. this. (rebecca) i' struggled with depssion. i thoughthi needed rettes to cope. i

>>> anan it's bightor faion. ""iven r carpepe isis morni wcountdowowtohe cacars >> andd rning, a heada into 88 annl amy awarhiilir rer c. rom n yorl.a. and around thehe orld, allll eyes s ll o hollywood's'lblb ear. at's whe paula and rob a rightw. >> >hey, sara. good morning again. n, dra. will b ding ght.thege will daddlehve 20200wavsmils and somego. check tout. that beti chris connelly bac with us wh a look at some of tonighghs front-runners. can'wait too heaea this >> this is so ue. this year, the o oar produdurs say they're shuffli the order of the awds. just one of the things to watch for tonight, including kudos for the year's highesrossing fi. tawa foraaks" y not up f btpictur t yeik to hear te outououtuc theni yo hearr performcucucuf three ninated songs. by lady gaga, returning to the os dpars second straight year. weekend. and sam smith. ll be singne a aienc member. gng)sg dirtlyy le% lyleo. thiss foror you,ba@ reord drio,,too, a best actor osca and ieararnas a chanceee ke ohm theest actress. >> that's t

molgiphg i me 83llr r: hseald anan eleringinr w ok te o to he. sooneave tot unte andt' o toew hampshe.theaten b paresowin f spring n t newhamp sng, evy. i'id w en candidaof wl nev e.their spses. es marriagrvive on the camp.ian'ho y wo or w you'rfrom.countr wejustdaop ghtiigh su evey . igy tfigh alwiieanexerci, faa bloosugaduwiype ab. e aay h r yo a aug's weht bod-pssdr farxa mahelpou weit anmay en weblooessure when uswi cerin diabetes menes. doe if allgic igor ingdits. mpto of rious lergretiluweg, iffilty eain orwallg. ou hany t syms stakiarxi do n takrxig youvereidoble are ialysi e der er. tellr do rigway youe bl or redolor iyour une orn whyou ate. a cause ouefs, idingehra, geniyeasfens womnd, losuga teruy se dapele am evedaop.ye. ah asyo dtor arxiga is right f you sifacow you itor (music mai'llever remrall e ojts taon or mtis i gavep my nhtfor. (music's drs innsy) buda le this,lleverort. t t er t 26 rde. benstoppab. ts is mfit so (mic mor lorado. we check with puawney philse wo grhog sees hiadow. i'your fotart :30 a.m. > mage ce ickyer anrcuman

masssse police presence outside thehexcel industrieie tnin heheton, kanafter a gunman tered the complex anan openen fire. workers inside the building described a chtic scene. sot / no id "everybo w w running, people were scrming, people were to d d" sot / d nd more people runng and all ofof sudden pop pop pop,p, stsrted running g o. when it was over fr peopop killed ing the gunmanmore itically. ses say e uuspt.. o wawaan employee of thehe plt.. was armewith hn t t yl apon and a handgun. police say thehean also shot and woundedee peopop encountererere the way to t t plant befe he weide andnopened fire. . soso/ no id t didn't' tter w it was he had no specififitaet, hehe just... oooong anyone who g t in his y." the fit ofofcer to arrive immediately engaged the nmnm and sine handnly toto himido. . sot / sheriff t. walt - harvecoyns :xx "even ough h htook fire, he wewewinside of tplacacand saved multiple, ltipip lives, a hero as far 'm concerned. out q 0 people were insidedehe plant atathe time of the shooting. police would n disisss a leadon what mayave e e gerethe sarah plake e thhat report...

. >> were there youtht ab bsas anan i vi.ortint hairss,ho t wo oseig wasnceed bytyer iotir. a wig becausy hairlieefror arow a prnd hha w ck >> 's tea colers to gwai ck,ut timei jufi. okayan they hfof aveomecoasitea od ey tt g t and to s p insend n de hgisheat f,e wof sethi ashad ivedy ba? ,war. and , i'ebti nd so if ie wnd mes piecnd , ebal t,'srtof t t id wanro nspi wos. oyou alkeou 'scoen nsid b tse s atin rtay ts ekrinna nn lehett brin t3lsam1.notoi whicmo th a ful sclap cmilenin g sh wenrthweste >>> moon i'te pstic scl i'moous. withis sgo th rgersamtl. he hard rt urithcuoc th's a o o bu f bin ywdew g e.on.chirmer ofed's g tlboae ec,oyit, wev fu msi ay i tihe d y es t crews ll thght. keks amory itn fohilltoin- sh r wi sou rais thercaat ...wrus e e ks fnegr er rtnit ng ns pervek.. has bug. imn tves ip g nt how t 2 cr .is mecoecasrrd ... abou30 tafoon in gi fi rig now. esosnt o ewju pour in. e rtmeeeteearlie w 10pet ntaine. s tryiilinghey ew ven es onhe all ng as t f p atta a a l ren d umhe e goa rk af em e grndrom e -hdr s are fiitor en it t ua, so wrernsmwaste dkowsk rd s

anan"mad m fury roro" wins foror st awards ofofhe n... tang homom6 oscars... mostly tecicalwards. ininhn besesestor categoryry. leo finally got his osfo pirformance in "the e revent"! this is leonardo dicaprio's fit acemy award d n ter r minations! "the revenant" alswofor best reor... "room" and thehupsesese theheight w in theheupporting actor category as "markrkylancewon for "bridge of spies",eating out sylvesr stallone... mark ralo and chririian bale.@ a judge is schedululcocoid etr ororototdisms defafationonsuitga bill cosb thananor wt modeja dkinsonas toe d)isiscause e say she haven dienaccounts of her interactions th cos overhe yeaea. dickikson suedosby in n y over his deal of her claims that he drugd and raped r in lake p tahoe in 12 ururufsus today y& erin anew civil suit against stalker michl barretetetd the nashvillmarriott. rretetpleaded guiltytyo stalkiki in 20-10 -- afder recording andrews -- nude rough peephole at ththhotel ----nd poing ththimagag online. apdrews is s sking 75-5-llion dollars inamages for staff told barrett which room drews s staying g . ter the breae

rnin d- willr courma the brinsi ofie rs la wiproteste na refu pear cour land egonafth akdy urayd ban anan an surrendered auoritie onll en erin a -doc o thfu. onlya w hos ie fal entsrresd vaanclendy--siar edofdn pti cuon, bu he e the heade ot a e n bu wa t dura thhoritrwa ca alad igroheay istu hurt.f do ythin that ough'mhurtg colo ri po he aind roers om nht r ende doanl nais onofheit whe ppen. e jos liveitng. ouid faf mu n pl. ceay aight. sha hewi arr ha awayreasotr bberis one aeyoad near aw el paso coun sherifs is t hasnils t d.rever. of thsu rberi arlar. cehesus yi ckwey aieor t . wl brg u inn beav inranga mo...krdo wsan. ac ens ywbe a get fi t ur. wel he ap y: there a urofloudthrning wirtia by af o sd g's fr it bsligcohi onminginto tnds. s cool aturesl tuallyout acar lito mate windoughou da exed: tempures willarm sl on saay, ghs gebacko the d 60s. anr we coront slidoughsatu t/suay g;ho a snl bested to cou whnor tions ibnday. loweel, stay dl in nek. is ofg! w abonau scy isttadto .. arly in spe. w hes ee the me iw in o goodorni coradohe's aoo ou ke uthmorng. oue anni ap nial nd i gointo c

anan entirety ans toaygog a drr thn t re tliosthnt. itco th m n thle d en fst will beparth hes nditions. av wstl ma wh delog toain snow-c ave coinfew spot thsday a ay oneheun but rarm ie her wi tak us io weeken hig shoueachhe 40tuayadib wp with abset thgs c cinu.s. wha w asngor n .. en iyo co gnd your lo atinniin doprepr wp on t gs chainin e y...a fe er ng f women .. lin a t. an in odni 'sou th w velotserinrgpolire g deabt ear-d ncerrviv..s und deh.o stanut en faci..m tath yo otl th07 tth toey: a rederminthe e ofbing ni mbin daugerfo tsud nc ess?olue. ?.able ement eeday ni se bedoor cl o lisa swa esdar bodion south gh. ng at on virgud nali s lpede r ea ekday hess fact gr li3 m, ged h onedthe hioostarhano rd hs eld,y al dlg ik? so at airhe t i he f yr d coll 4 le veat ui. chn wa areinlve wh lef liafly asppee thremainctpe o. ne0 miryrsona l itwiesthh s ba in skwhen o derssa sh dr rict atar mbobthu- lt byfens cpsmmnt sa e icd icd tgist fot.ac thmaer sd po a tion deb e e a drafedwas during nawar. fo aut r wars, thfoawak" at20 wae uge en wa

agaiore nfirs anane susp dbyolhl zgl8:-2itusso keang d jue omins tie e ive elcountyheriff gun.appeis after road and css pointtoo fafr thebrdmon tt sif rings. a t of eenehic ede ene use ll an tihoer detihe ty n oong asuall heerny . oe circle driveidorado springs. this is de days ago.on frida chthe road broke in an 11 call for actia stf all the bridges heructgs s repoerlyssa atwn wa engas if y bridarsa thisrionirne haocisuse ofer e-stctray fien brgeinoladspng er ullerspngdrer "y'ron onef e ids wi tm akg, kw at timet'like, this i nd oolan'shang it le ise"thtys,dgesabel truc t't cey unsafe but k. aron et/ci sen civil neers a riagement ani ant to shat t ges werense we w clothemhistd ne o42id , entith 6pe e idn anne n cheyen vd h rg of 2 "tone'resierar rep tweing be star wore withithonthd we'll be ing at egbert says th k brinspect ry 3 hs. heays rcle is of t anthworks we evenve. rt co sp chine oj he an ue about fire bng ort ca. ta thiweend duri arag erci. inow pcent ctaed d llt 12 reac e tateusit e t he e pectitilt t prtyast. new ten, toght ers comaon thye o png h di fhiinrin this hecora p

. >> he will be heading up anan investigation.n. >> allow me to introduce the nephew. >> crossing guard. >> belmont. >> come on. >> come to work on time. >> remember, first to find the guy gets the day off. >> it was a lot of fun and it was a movie where everyone was he never stifled us or stopped us and there was more about everybody getting into a position and serving a script, as opposed to ego arguments about who is and is not what. >> let's make this one for the books. >>o not move. >> i got into the training and weapons skill level was pretty -- >> he asked me and i was like, this will take work and i have not done that much with guns and i i arted working with navy seals gs and it was great to get into the mindset. skill set the guys have. >> i go to a gun range every two weeks. >> it is ok. >> ever since the hurt locker, i have found it very therapeutic and it is interesting, you know, when you get into the mental and physical aspec of firing a be. >> geez. >> i try to utilize that in my free time. >> this is the leader. do not make me regret this. >> when we come back, more fro

faith bible e @ chapal o o road iarvadada corpal cacaigan and o o her officece were shot w wle ing anan ictitiotice bailey.. 75-mis rtrtest of colorara springs. the's one last d tot campaign ahead of super tuesday. totorrow, miionsnsf voters will head to the polls ... putting ndreds of delegates upor grgrs in the r re r presidenen c's s ephanie ramos explains more about how e candidates stratagi. per tutuday`is tomomoow. is cououou be it?t? ?.where 595 dedegas ar foror grr rebls?s?an10 for decrin 1ates includ here en virgina?a?he n all is said and done oxes chchked?bal lots closed?t in both rties?or no it will provide a strong armeme fofothose whwhtata the most delegates, that they should be the nominee their party. but e rhetoric has inteied especiallyly amang repuicans in recenen days. sot - sen. ted cruz / presesent candnde "there havaven multle m miaepor ababt donald's business dealis wi the mob, wititthe mafia. natsot - sen. marco ruruo / prprididtial candidate "...small handsn" " after losing iowawagop frontrunner?do naldldrump? has seen his numbers in the polls and eltion day kee

roron anan wl be right her opening cememy. also j js cagl will be there, as ll. m m justt say the ful name it's openini ceremem livee fro thth redededet. jojoing us right now willl bee joe zee, yahootyle ed tore initornd jess cagle. e wle gang- we' yill be there. we also wtntn to talk -- iilll wake youup. jess, last yeare werere very careful and smart to ask sutantntntqueseson we didn' getnto a lot of fashionestions. will that be t me? ihihiss --hink lot@ of the actrees are still be about theashihi a a a also this y y y you've ao gothe wholeescars so white controvey and the acamy h s done a verer good job ofinmm to own tat cononrsation s think a lot of people coming down the red carpetill b preparededed maybe even excited to address that issue. >> ay. well, and y saidhe word >> d dresses because we still care abthe fashion. >> mostng transition've ever heard especially this early in the morning. we will benjg it. mayot make t tttour first estionononn t red carpet b cereainly be appreatinit. whic ofhe stars apprecie - whatrendnd will we se wve seen@ b big trends a

day,-b director jamomy f fing back, teing congress the case wonon be setting anan lel *or*r*echnological code t j has direcd ap write woror only on is one p pneneo the idea it getting oututn e wiwi and working on mone or&you phone at least the eerts ll me - not real ing." t,ongresseems vid on thessuu...me wmers y y they're prepepg slatio elelpplphehe i.whe ototrsemaiai skepcal about thprpracy imationshihisays: "if thisode extsa er in apple, it will prprumably become t targeof our soveign adrsaries, of criminal entererisesof terror."nwhi, st gal expes s e sangngt's unlily thes will getet erhingy nt in this case: napoli ss: "the gogogontorce a priva peon to rkrkt he pre pepu or inhis case e cocooratn doesn'want to?"ape sat will fht all the to t sup court needed.t,t,t, is hoping g avoid a plongng legal fight - ant dierences aside e the name of natnanaseritycomey ys"this the hdest qution i ie sen goveveme, and itit gon require netiion and conversation." (on-camag)the fbi says questions abo lawaw enforcrct acss to encrypd data should ultimatelye cided@by congress...to avoispute like thihiinhe

emr ear's obseancet fon waentu ok lili, , story y d cuur"l leerry veteran ghlighted e icancecece and anan of caca americs in the mityand spoke abouearly ers s the civil gh mement. 3 "the pt lps u mov forward d need that foror is nexgeraraon to rely tata what it tk to give thethe rihat they are vi by toy." toy.the speakers i atndance also spoke out thr fexpienceses and ared stori sinspiratio d wer. right .. a prceilamamouy po of shoankied o r fit cialftth viint w ur tosofsh in. .waot along thth o offics. whilredi tmost indethe spec oo. am usdy and a .cling murdinli oergudon juon ayay 3 "......"von ss: "tis onoy y willi countyolpartnt urth lof duty atin history ncnc1919 and heond r toe nioqlledn r history. storthdert't ve abo t stic cal..buy they toind hamilton wife dead, and t 1 1year olunrm.hamilton ia meer omyho woror attan.s exed to be arraignend (2/28). 3 doze oproteste cong on nset boulevar. rote the acady awards..they'r hoinsisis cainfor r more dirsity featu films.e of the 8h nualcamy awar..roiz b breverand al sharprpn.n. sharpton lling thisearseremony.whwhh feures an all-whititslat