58
58
Feb 1, 2020
02/20
by
KQED
tv
eye 58
favorite 0
quote 0
ing him season. ing him season. ing him season. ing him season. ing him season. se ing him on. ing him r ing him r ing him r ing him r ing him r by jimmy r by jimmy by jimmy r by jimmy r by jimmy r by jimmy r by jimmy by jimmy by jimmy by jimmy by jimmy by jimmy by jimmy the the the the the the the the the the the the >> let' hee ere hee ere hee ere >> let' >> let' >> let' >> let' >> let' let' let' let' let' let' let' let'as a let'as a let'as a let'as a let'as a let'as let'as a learnelet'as a learnelet'as a learnelet'as a learnelet'as a learnelet'as t' learne a learne learne learne learne learne learne leararnearnearnearnearnearnearn catcthe catcthe catcthe catcthe cathe catcthe catc catc catc catc tctc catccatccatccatccatctccatccatcc iculdifferent different differen r jor jor r jor jor jor jor joro robert: full speed hailed for senate republicans. seiday's critical vote on summoning witness fails after key g.o.p. senators stand down. >> i don't think there's a need for additional witnesses. ts robert: democry foul. >> no witnesses no, documents in an impeachment trial. it's a
ing him season. ing him season. ing him season. ing him season. ing him season. se ing him on. ing him r ing him r ing him r ing him r ing him r by jimmy r by jimmy by jimmy r by jimmy r by jimmy r by jimmy r by jimmy by jimmy by jimmy by jimmy by jimmy by jimmy by jimmy the the the the the the the the the the the the >> let' hee ere hee ere hee ere >> let' >> let' >> let' >> let' >> let' let' let' let' let' let' let' let'as a let'as a let'as a let'as a...
71
71
Feb 15, 2020
02/20
by
KQED
tv
eye 71
favorite 0
quote 0
heing he ing heing he ing heing he ing heyour ing he heur ing your ing heyour ing he your ing heyour ing he your were your were reyour your were your were your were your were were werewerewerewerewerewerewe yearre yearre yearre yearre ewthat ewthe the the the the tr that that that that that that that lina. that na. thlina. that lina. that lina. that lina. that lina. cast lina. cast lina. cast lina. cast lina. cast lina. cast na. cast cast cast cast cast cast ct at that that that that that tha to to to to to er an er an er an er an er an er an eraner aner aner aner aner aner bi bi bi bi bi buttig butt buttig buttig buttig buttig buttighe has buttighe has he has buttighe has buttighe has buttighe has buttigcoming buttigcoming buttigcoming buttigcoming buttigcoming buttigcoming we it anng amongclose eye in in in in in in thiswere thiswere thiswere thiswere thiswere thiswere thiswere thiswere thwere thiswere thiswere thiswere thiswere the onthisway. this that way. the on the on the on the on ements ements emthts a ement ements ements ememisememememememema n doesis withem withem them with
heing he ing heing he ing heing he ing heyour ing he heur ing your ing heyour ing he your ing heyour ing he your were your were reyour your were your were your were your were were werewerewerewerewerewerewe yearre yearre yearre yearre ewthat ewthe the the the the tr that that that that that that that lina. that na. thlina. that lina. that lina. that lina. that lina. cast lina. cast lina. cast lina. cast lina. cast lina. cast na. cast cast cast cast cast cast ct at that that that that that tha...
57
57
Feb 11, 2020
02/20
by
BBCNEWS
tv
eye 57
favorite 0
quote 0
let's just show you how good ings has been this season.uries, he's been banging them in for southampton — 1a league goals. compare him with other english strikers and only jamie vardy has a better minutes per goal ratio than ings. jamie vardy is not available to be picked for england by gareth southgate. he's leading the line for southampton — not since james beattie in the 2002/03 season has a saints striker been so prolific in the premier league. well, let's introduce you to alex parsons, then — footballer turned professional trainer who's been working with ings to recover from two serious knee injuries. lewis coombes has been to meet him. while most premier league stars were resting, this summer southampton striker danny ings was being put through his paces. the man cracking the whip was alex parsons, the pair played together for bournemouth‘s academy from the age of 1a while danny ings has gone on to play at the highest level, alex was released aged 20 afterjust one year as a professional. that was really hard mentally because you see
let's just show you how good ings has been this season.uries, he's been banging them in for southampton — 1a league goals. compare him with other english strikers and only jamie vardy has a better minutes per goal ratio than ings. jamie vardy is not available to be picked for england by gareth southgate. he's leading the line for southampton — not since james beattie in the 2002/03 season has a saints striker been so prolific in the premier league. well, let's introduce you to alex parsons,...
99
99
Feb 20, 2020
02/20
by
BLOOMBERG
tv
eye 99
favorite 0
quote 0
the ceo of ing to take over from sergio ermotti.is known for the digital transformation at ing and a --eran of the dutch banking banking -- a comparison to what's been happening here, hamers is a relative outsider to the rarefied world of swiss management. he has climbed the ranks. he was the head of the dutch and belgium banking units. he has been ceo since 2013. what he is known for is leading the digital banking push in an effort to win customers and he is also known for cost cutting, and that's what he has been doing, bringing ing back to profitability by reducing costs. sergio ermotti recently cut the bank's financial targets for the second time in as many years. we were reporting that the search for a successor was starting on friday. that news came through. the international wealth management cohead was widely seen as an eventual contender for the top rule. his run in with his former boss, tidjane thiam, apparently dimmed his standings with ubs board members. ralph hamers will be taking over at ubs. a lot of questions about h
the ceo of ing to take over from sergio ermotti.is known for the digital transformation at ing and a --eran of the dutch banking banking -- a comparison to what's been happening here, hamers is a relative outsider to the rarefied world of swiss management. he has climbed the ranks. he was the head of the dutch and belgium banking units. he has been ceo since 2013. what he is known for is leading the digital banking push in an effort to win customers and he is also known for cost cutting, and...
45
45
Feb 15, 2020
02/20
by
CSPAN2
tv
eye 45
favorite 0
quote 0
[laughter] >> having my husband, my children, my grandchildren, my dearest friends beside me hold ing hands; telling them each what they mean to me, that would be a good death. >> in order to make sure that you have autonomy in that process, in order to make sure that there's absolutely no mis take made about your desires, you recruited your grandson ben, tell us what you told them to do >> during the filming of the documentary which by the way will be shown on public television a year from now, that is in spring of 2021, ben was using his cell phone and i had asked my daughter, his mother for permission to do this, i don't do anything without asking my daughter. [laughter] >> for her permission -- >> if you've ever had the experience of dianne asking your permission to do anything -- >> well. >> you'd understand that it's not just an ask. >> it's very important with grandchildren and with children to ask permission and jenny granted it. i said, ben, i'd like to speak with you now, please take out your iphone as i was speaking with ben about my own desires, ben was being filmed by our
[laughter] >> having my husband, my children, my grandchildren, my dearest friends beside me hold ing hands; telling them each what they mean to me, that would be a good death. >> in order to make sure that you have autonomy in that process, in order to make sure that there's absolutely no mis take made about your desires, you recruited your grandson ben, tell us what you told them to do >> during the filming of the documentary which by the way will be shown on public...
94
94
Feb 20, 2020
02/20
by
CNBC
tv
eye 94
favorite 0
quote 0
banks as well as we have officially got a name for a successor ceo, the ing, ceo moving over there. the picture overall for europe starting slightly on the back foot this morning. >> let's dive into the details of earnings. starting with lloyds posting a 26% drop in the full-year pre-tax profit that came in at $4.6 billion it had to pay out billions to customers over miss sold payment protection >> elsewhere swiss re combined ratio, worsened to 108% despite posting the jump in the full-year profit it blamed the slump on natural and man made disasters ensuring it is still on the forefront of adverse trends. jewel yus bar regarding the football governing company fifa. it had already started implementing risk in response to the investigation. >>> in spain, europe's fourth largest telecom group. the key markets, spain, brazil, germany and britain all showed organic growth last year >>> travel and leisure with accor reporting a fall the french owe tell group said market conditions in asia deteriorated the unrest in hong kong as transport strikes in france impacted the corporate customers
banks as well as we have officially got a name for a successor ceo, the ing, ceo moving over there. the picture overall for europe starting slightly on the back foot this morning. >> let's dive into the details of earnings. starting with lloyds posting a 26% drop in the full-year pre-tax profit that came in at $4.6 billion it had to pay out billions to customers over miss sold payment protection >> elsewhere swiss re combined ratio, worsened to 108% despite posting the jump in the...
50
50
Feb 17, 2020
02/20
by
LINKTV
tv
eye 50
favorite 0
quote 0
waggoner: you know,ececadesf doing thwrwrong ing usuay kill yu. we goour deat warng in 200 wiiams: ifhere was polital willo make se tt t thisity seesnother00 yeyearsit wouldean n hang verbeautil, veryesthetic bluews along th greenys througho the cit us livi with ter, so at when at next storm comesbebecausit''s gog to com-that's a fact at wateras a p pce to go other th your ca and your omes andhe stree [flm advan clicks] reed: asome poi after huricane krina, pele startetoto getealllly riousus about coast i issue and the started to thinabout ri reductio p proteing peop from floong, , totherer wh restorati a as onthining at needs to be drdresse andnd s we came up with this cotatal mter planhich is a list o projects atat hae bebee scientifical v vette andnd s we have pjejects at d dree materialrorom onplacace d putt it in anheher ple toto auallyy build n m marsh wheherehere''s open waer at thmoment. e risk-reduction side, have xtxtense seseri of levees a f floodtes s arnd some ititicaloaststal communieies. tse a arerojectct aat wehinknk wl workrknot w
waggoner: you know,ececadesf doing thwrwrong ing usuay kill yu. we goour deat warng in 200 wiiams: ifhere was polital willo make se tt t thisity seesnother00 yeyearsit wouldean n hang verbeautil, veryesthetic bluews along th greenys througho the cit us livi with ter, so at when at next storm comesbebecausit''s gog to com-that's a fact at wateras a p pce to go other th your ca and your omes andhe stree [flm advan clicks] reed: asome poi after huricane krina, pele startetoto getealllly riousus...
97
97
Feb 5, 2020
02/20
by
KQED
tv
eye 97
favorite 0
quote 0
he has been tweet ing away, i s. gary: there is one very curious tweet which viewers should take a lo at them in which he has tweeted a mockup of a cover of az"time" me with the dates and eventually it pops up "trump forever." maybe he is planning to stay around a little bit longer. there has been a statement from stephanie grisham, white house secretary,aying that the bush white house press secretary, saying that the president has been totally vindicated and slams democrats from naming adam schiff and nancy pelosi, and asked the question quite ominously in this statement, "will there be no retribution?" unclear what he means by that. also hav romney for voting for the first article from the onen republi who broke on one of the articles. we will get statement from the president tomorrow at noon. we are expecting him to address the aftermath of the impeachment process. we will see what his mood will be inerson, i think. laura: gary, just how disappointed is the ite house by the fact that mitt romney did break ranks an
he has been tweet ing away, i s. gary: there is one very curious tweet which viewers should take a lo at them in which he has tweeted a mockup of a cover of az"time" me with the dates and eventually it pops up "trump forever." maybe he is planning to stay around a little bit longer. there has been a statement from stephanie grisham, white house secretary,aying that the bush white house press secretary, saying that the president has been totally vindicated and slams democrats...
58
58
Feb 14, 2020
02/20
by
LINKTV
quote
eye 58
favorite 0
quote 1
soso we have to o look after o a ing g to asturtrtles. turtle? it takes 30 years for turtlest. afafter nesting,g, they travelel thousandnds of kilometeters bao the great t barrier reefef n auststralia. impoportant role t they play inn hehelps thconservavation.dnd t >> women are very important because we are the custodians. we are the ones o look after the mimily, weeed d our >> women are very important because we chililen.ustodians. we too prerepare the feast and whatever is hahappeninin t the commununity. so i it is very imimportant the
soso we have to o look after o a ing g to asturtrtles. turtle? it takes 30 years for turtlest. afafter nesting,g, they travelel thousandnds of kilometeters bao the great t barrier reefef n auststralia. impoportant role t they play inn hehelps thconservavation.dnd t >> women are very important because we are the custodians. we are the ones o look after the mimily, weeed d our >> women are very important because we chililen.ustodians. we too prerepare the feast and whatever is...
113
113
Feb 16, 2020
02/20
by
CSPAN2
tv
eye 113
favorite 0
quote 0
in 1970's particularly disturb ing piece of information comes out.his stuff not only stays there, gets out to living things that are exposed to chemical; absorb it and gets into the blood and stays there. not only persists in the environment, persists in living things and every little bit will build up in your blood, in your body, by 1970's 3m and dupont were aware that this stuff was getting into human blood, okay, i'm looking at the studies; they knew this was getting into human blood not just work efers but a cross the united states. okay. and they start monitoring the workers to see what kind of effect this has, by the 1970's , it's toxic and getting into people, the tinniest amount s are building up, so dupont is very concerned about this and start saying, well, we are admitting this into the air and water, they do modeling, they see the air emissions are going to ohio, and also ohio river, there's a public water supply fill right next door. they go out and sampling water supplies, the chemical is in the drinking water in ohio and west virginia.
in 1970's particularly disturb ing piece of information comes out.his stuff not only stays there, gets out to living things that are exposed to chemical; absorb it and gets into the blood and stays there. not only persists in the environment, persists in living things and every little bit will build up in your blood, in your body, by 1970's 3m and dupont were aware that this stuff was getting into human blood, okay, i'm looking at the studies; they knew this was getting into human blood not...
50
50
Feb 20, 2020
02/20
by
CNBC
tv
eye 50
favorite 0
quote 0
and ing. sergio armani is stepping down from global swiss banking giant for ultra high net worth who do they tap to run it? a guy who has done retail banking and insurance at a dutch lender to come and do that sort of thing why? he has experience with taking on deposits, also with the digital and financial technology ing at one point, even here in the united states had ing direct. >> sure. >> goldman has the market savings platform now. >> yes. >> that's all happening at the same time. >> rich, that's why i do wonder if tra tishl wall street has been shrinking, this business is going, what should goldman's next move be all those stocks are trading up today, perhaps in the hope that someone will be the next target. do they look at a start-up like robin hood or stick with what they've been doing >> i think the other assets are trading up, but to acquire something else right now will be expensive for goldman. i think goldman has probably made the biggest inroads digitally of the big banks from a
and ing. sergio armani is stepping down from global swiss banking giant for ultra high net worth who do they tap to run it? a guy who has done retail banking and insurance at a dutch lender to come and do that sort of thing why? he has experience with taking on deposits, also with the digital and financial technology ing at one point, even here in the united states had ing direct. >> sure. >> goldman has the market savings platform now. >> yes. >> that's all happening at...
25
25
tv
eye 25
favorite 0
quote 0
eruption affect cases began and there's also been a certain amount of to ing and fro ing between scientists as to how serious an alarming this. outbreak of corona virus is some saying that in actual fact it's the panic that is more dangerous than the reality of disease that in many cases it is simply like a bad case of flu when people can stay at home and just get her grip with rest and medicine so. it's not very clear really at what we should be believing about this and italians are a fairly from extent at the moment ok phil thanks very much for that from rome. and we have much more on that run a virus at our you tube channel and our website here in germany the center left social democrats have won sunday's election in the city state of hamburg with 39 percent of the vote now this victory marks a turnaround for the party its support has fallen sharply in other recent state elections hamburg's voters though punished chason ackles christian democrats the conservatives received just 11 percent of the ballots. was was was. finally a result to celebrate for germany's ailing social democrats aft
eruption affect cases began and there's also been a certain amount of to ing and fro ing between scientists as to how serious an alarming this. outbreak of corona virus is some saying that in actual fact it's the panic that is more dangerous than the reality of disease that in many cases it is simply like a bad case of flu when people can stay at home and just get her grip with rest and medicine so. it's not very clear really at what we should be believing about this and italians are a fairly...
38
38
Feb 6, 2020
02/20
by
BBCNEWS
tv
eye 38
favorite 0
quote 0
ings had his 17th goal of the season, his best return for six years and in england recalled may not be lead barely lasted for six minutes. lucas moura made it 2-2. six minutes. lucas moura made it 2—2. exeter time was looming in cell sunny kooyong men was awarded a penalty for a file —— son. he put the spot kick away himself to send totte n ha m the spot kick away himself to send tottenham into the last 16, a home tie against norwich city. we played against the team that was the best on the pitch. they were better than us but we deserved to win. because they were in their limits. we did not have rest, very difficult, i think we were in our limits. four matches to go over two rounds. two rounds, four matches, really ha rd rounds. two rounds, four matches, really hard for the boys. so i think they deserve this happiness. elsewhere, bayern munich are through to the quarter—finals of the german cup after coming from behind to beat bundesliga rivals hoffenheim 4—3. the two sides traded own goals before thomas muller put the holders in front for the first time mid—way through the first half.
ings had his 17th goal of the season, his best return for six years and in england recalled may not be lead barely lasted for six minutes. lucas moura made it 2-2. six minutes. lucas moura made it 2—2. exeter time was looming in cell sunny kooyong men was awarded a penalty for a file —— son. he put the spot kick away himself to send totte n ha m the spot kick away himself to send tottenham into the last 16, a home tie against norwich city. we played against the team that was the best on...
83
83
Feb 14, 2020
02/20
by
BBCNEWS
tv
eye 83
favorite 0
quote 0
ing told us this is a good step forward -- china economist.he september one list is representing that there is a truce in not putting more tariffs on each other. this is a good thing. during the coronavirus, i don't think that china can import a lot from the us and also from the rest of the world. so, how is that going to be viewed by washington? is that going to be considered as an extraordinary circumstance, as phrased in the phase one agreement? in the phase one agreement there is a clause that allows china to delay buying us products within a calendar year, but not deferring more than a calendar year because they have some kind of quotas for each year. so we will see how china reacts. but definitely china will defer the imports within this year. and just when you might expect tensions between the two economic giants to between the two economic giants to be easing, washington has actually added more charges against a chinese telecoms giant huawei, accusing it of stealing trade secrets for years. samir hussein has more and this was that the
ing told us this is a good step forward -- china economist.he september one list is representing that there is a truce in not putting more tariffs on each other. this is a good thing. during the coronavirus, i don't think that china can import a lot from the us and also from the rest of the world. so, how is that going to be viewed by washington? is that going to be considered as an extraordinary circumstance, as phrased in the phase one agreement? in the phase one agreement there is a clause...
26
26
Feb 15, 2020
02/20
by
CSPAN2
tv
eye 26
favorite 0
quote 0
in 1970's particularly disturb ing piece of information comes out.is stuff not only stays there, gets out to living things that are exposed to chemical; absorb it and gets into the blood and stays there. not only persists in the environment, persists in living things and every little bit will build up in your blood, in your body, by 1970's 3m and dupont were aware that this stuff was getting into human blood, okay, i'm looking at the studies; they knew this was getting into human blood not just work efers but a cross the united states. okay. and they start monitoring the workers to see what kind of effect this has, by the 1970's , it's toxic and getting into people, the tinniest amount s are building up, so dupont is very concerned about this and start saying, well, we are admitting this into the air and water, they do modeling, they see the air emissions are going to ohio, and also ohio river, there's a public water supply fill right next door. they go out and sampling water supplies, the chemical is in the drinking water in ohio and west virginia.
in 1970's particularly disturb ing piece of information comes out.is stuff not only stays there, gets out to living things that are exposed to chemical; absorb it and gets into the blood and stays there. not only persists in the environment, persists in living things and every little bit will build up in your blood, in your body, by 1970's 3m and dupont were aware that this stuff was getting into human blood, okay, i'm looking at the studies; they knew this was getting into human blood not just...
36
36
Feb 29, 2020
02/20
by
KRON
tv
eye 36
favorite 0
quote 0
but there are going to be we're not ing to be perfectly prepared. because we've never gone through this before. so the most important thing is we learned very quickly and change practices as fast aswe can. i do think t's important that hospitals get prepared you know we're here 're seeing here. london breed did the state of emergency not because we ha cases in san francisco. but because she wants to have the tools in place to be able to react quickly and nimbly when we start to have cases that's the kind of uff we should be approaching you know in a step-by-step fashion lower out oftime doctor up we could go on for a long time there are a lot ofquestions asked but we appreciate yogiving that information thank you for having wash your hands. >>okay, we have a section dedicated to the coronavirus on our website and you can find our speciareport on how to stay safe from the outbreak you can find a special map that shows where the cases have been eported in the united states and much more it is all at kron 4 dot com. ok let's step outside right now see
but there are going to be we're not ing to be perfectly prepared. because we've never gone through this before. so the most important thing is we learned very quickly and change practices as fast aswe can. i do think t's important that hospitals get prepared you know we're here 're seeing here. london breed did the state of emergency not because we ha cases in san francisco. but because she wants to have the tools in place to be able to react quickly and nimbly when we start to have cases...
58
58
Feb 10, 2020
02/20
by
BLOOMBERG
tv
eye 58
favorite 0
quote 0
we are back with chris turner, ing head of fx strategy. big is politics in the rise of the dollar? chris: you've got some interesting charts showing the probability of an election win for donald trump the moment, and they have just been rocketing over the last three or four weeks, whether because of what happened in iowa. it is hard to put your finger on it. so far, there are no signs that was going on in the democratic space is enough to challenge donald trump at the moment. i think were u.s. data to slow somewhat or perhaps some success come through on the democratic side -- i am not quite sure how you define success on the democratic side -- but there hasn't really been enough. democrats obviously didn't cover themselves in glory. guy: the president would like to see a weaker dollar. chris: i think it would be very hard frame to talk the dollar down. it got up to $100 last summer, and that was a point where he doesn't like a strong dollar. what can he do about it? normally, he would complain that fellow trading partners are undervaluing
we are back with chris turner, ing head of fx strategy. big is politics in the rise of the dollar? chris: you've got some interesting charts showing the probability of an election win for donald trump the moment, and they have just been rocketing over the last three or four weeks, whether because of what happened in iowa. it is hard to put your finger on it. so far, there are no signs that was going on in the democratic space is enough to challenge donald trump at the moment. i think were u.s....
185
185
Feb 16, 2020
02/20
by
KRON
tv
eye 185
favorite 0
quote 0
ing i had. i >>it's close tonig after a man is wounded in an officer-involved shootin bart police say they shot the man while he ran out of a bar car and on to the tracks. >>i'm j r stone a i'm justine waltman thoicers were responding to a domestic disturbance call at the serino to norte a tation just before 2 o'clock this afternoon, the shooting foe the station to be closed for several hours. krn four's dan thorn has been following the stor for us tonight, he joins us now live from el serino with the very latest >>well, jr and justine it's stl pretty active here as investigators are still collecting evidence and they'veactually had to turn people away at the staon here as well as at the chmond bart station because the investigation is still ongoing police were able t recover a handgun here at this station, but the is still a lot unknown. ey also del norte a bart staton swarmed by pole following an officer-involved shooting bart police say the officerere responding to an argument between a man a
ing i had. i >>it's close tonig after a man is wounded in an officer-involved shootin bart police say they shot the man while he ran out of a bar car and on to the tracks. >>i'm j r stone a i'm justine waltman thoicers were responding to a domestic disturbance call at the serino to norte a tation just before 2 o'clock this afternoon, the shooting foe the station to be closed for several hours. krn four's dan thorn has been following the stor for us tonight, he joins us now live from...
55
55
Feb 26, 2020
02/20
by
KRON
tv
eye 55
favorite 0
quote 0
they do custom box and they're ing released ahead of tional peanut butter day live from the nasdaq, i'meking all ig, thanks jane can if the creator says it's jeff the creator says it's shift. >>but you mean >>it created e taban ok al gore even that of the internet kron 00:04am morning for a car in the south they will tell you how firstesponders rushed to the scene to help out the new rents there's a live lookoutside the bay bridge this morning as traffic is slowly moving along robin winston with another mmute ...at thright prices start with lowe. shop our bath savings event and get up to... and finish it off with 4al-scrub stain resistant... valspar tra interior paint plus primer starting at $24.98 a gallon. do it right for less. start with lowe's. i wanted my hepatitis c gone. i put off treating mine. epclusa treatsll main types of chronic hep c. whatever your type, epclusa coulbe your kind of cure. i just found out about mine. i knew forea epclusa has a 98% overall cureate. i had no symptoms of hepatitis c mine csed liver damage. epclusa is only one pill, once a day, taken with or wit
they do custom box and they're ing released ahead of tional peanut butter day live from the nasdaq, i'meking all ig, thanks jane can if the creator says it's jeff the creator says it's shift. >>but you mean >>it created e taban ok al gore even that of the internet kron 00:04am morning for a car in the south they will tell you how firstesponders rushed to the scene to help out the new rents there's a live lookoutside the bay bridge this morning as traffic is slowly moving along robin...
66
66
Feb 16, 2020
02/20
by
LINKTV
tv
eye 66
favorite 0
quote 0
waggoner: you know,ececadesf doing thwrwrong ing usuay kill yu. we goour deat warng in 200 wiiams: ifhere was polital willo make se tt t thisity seesnother00 yeyearsit wouldean n hang verbeautil, veryesthetic bluews along th greenys througho the cit us livi with ter, so at when at next storm comesbebecausit''s gog to com-that's a fact that wat has a alace to go other an your rs and yr homesnd the seet. ilm advce click reed:t some pnt after hurrica katrina, ople stard d to g reaeallserioio about coaalal isss, and ty started to thk about sksk reductn,n, procting pele from fldingng, geththerith restoraonon as e ththinthat needs to badaddresd, a ando we came up with this asastal aster pl which is a listff projectsththat ve e ben scientificlyly vetd, a ando we haverorojectthatat ddge materi f from e plplacand pupu it in otother ace e toctuallll buildewew mares w whe therer's open ter at e momenton the risk-reduction sidewewe haveextenive e sees off leveesndnd flogatetes ound somcrcritic coaoast commitities.hesese a projejes that wehihink wl woworknot w
waggoner: you know,ececadesf doing thwrwrong ing usuay kill yu. we goour deat warng in 200 wiiams: ifhere was polital willo make se tt t thisity seesnother00 yeyearsit wouldean n hang verbeautil, veryesthetic bluews along th greenys througho the cit us livi with ter, so at when at next storm comesbebecausit''s gog to com-that's a fact that wat has a alace to go other an your rs and yr homesnd the seet. ilm advce click reed:t some pnt after hurrica katrina, ople stard d to g reaeallserioio about...
82
82
Feb 15, 2020
02/20
by
LINKTV
tv
eye 82
favorite 0
quote 0
announcer: on this episode of "earth focus," lessons learned durg g hurrane e kaina arar ing put to the test alonthe coast of losisiana. meme prect n newrleansnsill submerd d by te enendf thisis cetutury. e reregi' survival depen on its ility todapt to clite chang if sucecessfu lououisna mayay provi a a blurintnt f otherer ound theorld. [film advae clicki]] ccker:herere we famimies hee.e. the werere ds in n e streetlaying ftball, right? ere wereeighborsthis houswas the ndy ladyas kids, wwould co down nd spendur quarts and sitere on ts porch d eat it and jt t enjothe e atspherere ofththe counitity,ight, , d aat we awaway st oveveight. it just got whehed aw. [heliptpter wrrining] man: a are sing g sces likik isis onehrouought the e ty. lieberman: y you rembeber if you told them atat th levs had broken? brown: dodon't recall spififical, bubut was t tt ww orlns i is oodingng waers: no.it. knckcked or ththemlants s their poch lastninight,uh?h? miss is some seset wi youou. aououple mononthago, w whad a rain storm, jt t a ornaryry instorm in southstst louisian i it waone e of those days that t
announcer: on this episode of "earth focus," lessons learned durg g hurrane e kaina arar ing put to the test alonthe coast of losisiana. meme prect n newrleansnsill submerd d by te enendf thisis cetutury. e reregi' survival depen on its ility todapt to clite chang if sucecessfu lououisna mayay provi a a blurintnt f otherer ound theorld. [film advae clicki]] ccker:herere we famimies hee.e. the werere ds in n e streetlaying ftball, right? ere wereeighborsthis houswas the ndy ladyas...
53
53
Feb 22, 2020
02/20
by
KQED
tv
eye 53
favorite 0
quote 0
and i think se responded to it ing "we're gonna get you to church as much as possible." [smith] more church is the answer. [jones] more church is the answer. and so we were going to church suddenly, three or four nights a week not including sunday mornings. it was just a lot, i felt like it was all we did. [smid looking back now you don't begrudge her. [jones] i don't begrudge her, it was a mistake. it culminates in a terrible mistake. because at the begrudge end of the summer,ke. she takes me to the front of the church, takes me up to this man that i did not know. d i remember thinking about that, we've never even spoken. she says "this is my grandson, saeed. "his mother is buddhist." and he just nodded lthat was he would ever need to know about me, and my mother, who he also absolutely had not met, right? and he just stard to pray. and then he said "god, this boy's mother "has gondown the path of satan "and decided to drag him down too." [smith] right. [jones] and speaking of dialogue, ngi do remember everyte said. [smith] that he said. [jones] i will remember it for t
and i think se responded to it ing "we're gonna get you to church as much as possible." [smith] more church is the answer. [jones] more church is the answer. and so we were going to church suddenly, three or four nights a week not including sunday mornings. it was just a lot, i felt like it was all we did. [smid looking back now you don't begrudge her. [jones] i don't begrudge her, it was a mistake. it culminates in a terrible mistake. because at the begrudge end of the summer,ke. she...
66
66
Feb 28, 2020
02/20
by
KRON
tv
eye 66
favorite 0
quote 0
twith your goo ragtag group of misfits,ing somehow wins it all, mov. twitremember guys,tag gglory lasts forever. bottle that confidence, mi. tonight, la quinta. torrow you triumph my sons were in their tes. when i camso i got involvedn in juvenile justice, i didn't want them to go through the same thing i went through michael bloomberg created the young men's initiative. in helping keep other young men and young women from entering in the crimil justice system. and we see it, we see it in young people being employed. we see youngeople being removed out the system. running for president, what betr platform for h to sak about real justice, real refm. i'm mike bloomberg and approve this message. to give his money to charity, giving pledge when thicalifornian lked away from his billion dollar company r good. he drives a chevy volt, flies commercial, and spends his days building assroots campaigns fosocial and environmental justice. why? tom steyer bieevery ild deserves the same opportunits as his. a healthy planet. good sools. quality healthca, living wage
twith your goo ragtag group of misfits,ing somehow wins it all, mov. twitremember guys,tag gglory lasts forever. bottle that confidence, mi. tonight, la quinta. torrow you triumph my sons were in their tes. when i camso i got involvedn in juvenile justice, i didn't want them to go through the same thing i went through michael bloomberg created the young men's initiative. in helping keep other young men and young women from entering in the crimil justice system. and we see it, we see it in young...
49
49
Feb 27, 2020
02/20
by
CSPAN
tv
eye 49
favorite 0
quote 0
for also about respect science, for evidence-based it's about ing, and having so much of that talent proud of in our public health sector be countries so ther that we can get a true, a true and accurate true assessment of what is happening countries. they may have the best intentions, but they may not we say, even with ost talent they may have, they don't have the value added that omeone from our country could lend. so in any event, we look forward, as i say, to working a bipartisan way and hopefully, you know, again, in a about our way concerns about past performance or statements that are made. in perspective as we move forward to have the dequate funding, the respect for science and evidence-based ecision-making and, again, reimbursement for state and impactsvernment and the it's having in our communities. speaking of community, i had the privilege on monday of having a through china -- walk town.h china i always feel very privileged to nd say -- my poor colleagues when they go home, they don't have the advantage of this in myful diversity i have district. sadly, china town is bei
for also about respect science, for evidence-based it's about ing, and having so much of that talent proud of in our public health sector be countries so ther that we can get a true, a true and accurate true assessment of what is happening countries. they may have the best intentions, but they may not we say, even with ost talent they may have, they don't have the value added that omeone from our country could lend. so in any event, we look forward, as i say, to working a bipartisan way and...
77
77
Feb 21, 2020
02/20
by
KQED
tv
eye 77
favorite 0
quote 0
haedra icis sma i ps oin.so society and is responsible for ouriaed m l hoctiidavfiedre ing documentsnd videos.e posted onli this is a screenshot from one of those videos. we also know he publis letter, apparently claiming responsibility for this attack. a terrorism expert has seen this man's so-called manifesto. hes says he hareigners and nonwhites. he calls for theof extermination arious countries in north africa, the ddle east, and central asia, which happened t be pejoratively -- which happeno be majority muslim. here's more asibe heves in racil periorityhatsuperior-ity, - ents need to be eliminated. he is anti-muslim, anti-jewish. there are other things he believes. he's the conspiracy theorist or s believed to be ad. he thought that the security seisices were looking into head down trying to control his thoughts. ros: next, the reaction of a najo frstankfurt. he came tgermany in the 1990's. ifi really am playing with it will not be a better idea to look for other places to live for my family. it is not the fst racist attack in germany. it becomes more and more normal. ros: europ
haedra icis sma i ps oin.so society and is responsible for ouriaed m l hoctiidavfiedre ing documentsnd videos.e posted onli this is a screenshot from one of those videos. we also know he publis letter, apparently claiming responsibility for this attack. a terrorism expert has seen this man's so-called manifesto. hes says he hareigners and nonwhites. he calls for theof extermination arious countries in north africa, the ddle east, and central asia, which happened t be pejoratively -- which...
189
189
Feb 20, 2020
02/20
by
KQED
tv
eye 189
favorite 0
quote 1
the president, has, a as we know, been toying with the idea, retweeting fox news hostca ing him very specifically to do that, but we just don't kw yet. >> woodruff: well, we will continue to watc it. william brangham, fascinating story. thank you. >> woodruff: in the day'other news, there is word that intelligence officials warned house lawmakers last week that russia was trying to interfere in the 2020 presidtial campaign in a bid to get president trump re-elected. that is according to the "washington post" and the "new york times." president trump allegedl lashed out at his now-outgoing acting director of natiol intelligence, seph maguire. the coronarus appears to be spreading at a slower rate in china, as the number of new f cases there fe another day. in all, the country has recorded arly 75,000 cases, and more than 2,100 deaths. meanwhile, japan reported its first deaths from a quarantined cruise ship-- an elderly japanese couple. world health organization officials said that while the number of cases outside china i small, still a concern. >> it doesn't mean that all the number
the president, has, a as we know, been toying with the idea, retweeting fox news hostca ing him very specifically to do that, but we just don't kw yet. >> woodruff: well, we will continue to watc it. william brangham, fascinating story. thank you. >> woodruff: in the day'other news, there is word that intelligence officials warned house lawmakers last week that russia was trying to interfere in the 2020 presidtial campaign in a bid to get president trump re-elected. that is...
359
359
Feb 11, 2020
02/20
by
KQED
tv
eye 359
favorite 0
quote 0
one ing to keep in mind is how this state is split. look at a graphic of who the vote are in this stat look at this: there are almost as many who are declared as republic and aswo"ratic, but there are many more voters here who are undecled. they're independent, and amna, those are vote, being targeted by all these campaign, and they tell me that frankly they neited o stop. and it's moving them the other way. >> nawaz: lisa, we should mention last nightou covered that rally that judy was lporting on a little while ago of president trut night in new hampshire. he's the man all of these candidates say they want to be in novembe y wh were talking to people there in new hampshire who like and support this president, what are they telling you right now? >> ths ere iimmense support for donald trump. remember, this is a swstate in november. amna, at that rally, there were such roars of approval. when you talk to trump voterswh here they like about this president, they say he's getting things done and almost to aha person theye all told me we t
one ing to keep in mind is how this state is split. look at a graphic of who the vote are in this stat look at this: there are almost as many who are declared as republic and aswo"ratic, but there are many more voters here who are undecled. they're independent, and amna, those are vote, being targeted by all these campaign, and they tell me that frankly they neited o stop. and it's moving them the other way. >> nawaz: lisa, we should mention last nightou covered that rally that judy...
33
33
Feb 29, 2020
02/20
by
KQED
tv
eye 33
favorite 0
quote 0
to say nothing of the actual tragedy of people ing. properly gets destroyed.all sorts of things make it hard for an investor to tolerate.>>> in terms ofan californiathe bay area. we have a strong indian american population here. 1-5 indian americans live in california. we have a large almond market. india is one of the largest imports of california almolas. what other onships exist? what about the future question mark >> attack sector the u.s., tyindia, california, indiis known for. there are agricultural relations. for india, going forward. the tech sector 10% of the economy but it's not the jobs. jobs are in other services. think about how you can continue to grow the tech ec sector andomy as a whole while producing jo. that becomes a big challenge for india. shapes relations in terms of how the tech sector develops.>>>ofthere was hope the trade deal. it ppdidn't . india said they would buy iiib in dollars wort ofweapons. what is the deal? >> we may see something dealer -- smaller. the elections are in november. the u.s. will be campaigning and won't have en
to say nothing of the actual tragedy of people ing. properly gets destroyed.all sorts of things make it hard for an investor to tolerate.>>> in terms ofan californiathe bay area. we have a strong indian american population here. 1-5 indian americans live in california. we have a large almond market. india is one of the largest imports of california almolas. what other onships exist? what about the future question mark >> attack sector the u.s., tyindia, california, indiis known...
153
153
Feb 14, 2020
02/20
by
KPIX
tv
eye 153
favorite 0
quote 0
and a 17-year-old, they are accused of pill ing up their vehicle next to a van outside an elementary school and you're looking at a neighbor's security cam and they were shooting and killed the two boys hanging outside that van. it was november 2019. they were 14 and 11 years old. their names kevin hernandez and sean withing ton. both suspects were already in custody on unrelated charges. >> it may not extinguish that anguish, that disbelief, that apprehension but maybe it brings a sense of direction and purpose that we have to find some conclusion, some resolution to these types of senseless acts of vice lense. >> detective had search wants last week and found multiple guns including an ak-47 assault rifle, $60,000 of marijuana and methamphetamine and $10,000 in cash. the suspects in the case are facing murder charges as well as a gang enhancement. investigators are keeping much of the investigation under wraps right now, but they say it was done with the help of electronic and physical surveillance and there are other persons of interest out there and more arrests may come. >>> and
and a 17-year-old, they are accused of pill ing up their vehicle next to a van outside an elementary school and you're looking at a neighbor's security cam and they were shooting and killed the two boys hanging outside that van. it was november 2019. they were 14 and 11 years old. their names kevin hernandez and sean withing ton. both suspects were already in custody on unrelated charges. >> it may not extinguish that anguish, that disbelief, that apprehension but maybe it brings a sense...
105
105
Feb 5, 2020
02/20
by
KQED
tv
eye 105
favorite 0
quote 0
narrator: ing for this presentation is made possible by... man: babbel, a language learni that teaches real life conversations and uses speech recognition technology. daily 10 to 15 minute lessonss are voiced by natiakers and they are at babel. b-a-b-b-e-l.com. ator: funding was also provided by... the freeman foundation. by judy and peter blum-kovler foundation. pursuing solutions for america's neglected needs. and by contributions to this pbs station from viewers like you, thank you. woman: and now, bbc world news. welcome to "outside source." in the u.s., there are still no results om the iowa caucus, where the first test to select a democratic cdidate descends into farce. britain orders british people to return immediately because of the coronavirus. t we will look ahow bad the crisis is as the who attempts to reassure people it is not th easy toatch. >> it is transmitted through droplets and unique close contact to be affected bands on the sales of petroard diesel and hydro cars to 2035. we will look at how feasible that is good and a fi
narrator: ing for this presentation is made possible by... man: babbel, a language learni that teaches real life conversations and uses speech recognition technology. daily 10 to 15 minute lessonss are voiced by natiakers and they are at babel. b-a-b-b-e-l.com. ator: funding was also provided by... the freeman foundation. by judy and peter blum-kovler foundation. pursuing solutions for america's neglected needs. and by contributions to this pbs station from viewers like you, thank you. woman:...
141
141
Feb 1, 2020
02/20
by
KQED
tv
eye 141
favorite 0
quote 0
ing us tonight. karoun demirjian, congressionalt reporter f "washington post."ake sherman, sister writer and co-author of political play book. carl hulse chief washington core portant for "the new yo times" and here with me at the table, ayesha rasc, white house reporter for national public radio and susan page, washington brewo chief for usa today. t's start witthe dean of senate reportering, carl hulse. th e's been a question abo the timing of the final vote on the articles of impeachment. what can you tells about the politics and negotiations behin thatcision? >> a lot of wrangling going on tryingo get to an end game here. so what has happen sled that there's been a decision that was cleared with perspective trump to have a final vote on wednesday. i think at 4:00 p.m. now, that's important, because the state of the union, of course, is on tuesday, so thet impeachmill still be going on. the trial. so first on'l monday, y have closing arguments from the defense and the house managers. nesn the floor will be open, the chief justice won't in the charpe for speec
ing us tonight. karoun demirjian, congressionalt reporter f "washington post."ake sherman, sister writer and co-author of political play book. carl hulse chief washington core portant for "the new yo times" and here with me at the table, ayesha rasc, white house reporter for national public radio and susan page, washington brewo chief for usa today. t's start witthe dean of senate reportering, carl hulse. th e's been a question abo the timing of the final vote on the...
96
96
Feb 23, 2020
02/20
by
CSPAN3
tv
eye 96
favorite 0
quote 0
exploding]ing, there are heavy defenses on the ridge overlooking this plain. a bead on us again. [explosions] they chase us off there five times. we came back six. music, sad music] ♪ we brought in our wounded and took a breather. the injured are carried to the rear. plasma is given on the way. hospital dugouts are ready for anything. and we are ready to advance again. [whistle] we call for artillery. [explosions] an artillery duel develops at night. [explosions] one of our ammunition dumps goes up. [explosions] ♪ uptwo weeks we have cleaned plenty of japanese between here and suribachi. many to bere still taken out with thousands fighting from pillboxes and case. we have to go in and dig them out one by one. [machine gun fire] ♪ what we cannot dig them out, we .urn them out ♪ [suspenseful music] while we fought, we prayed. ♪ music]ul wreckage along the beach was only a small cost of 26 days of fighting. -- only a small part of the cost of 26 days of fighting. ♪ beautiful queenie and there are other names too. the names of our friends. we stack the helmets of
exploding]ing, there are heavy defenses on the ridge overlooking this plain. a bead on us again. [explosions] they chase us off there five times. we came back six. music, sad music] ♪ we brought in our wounded and took a breather. the injured are carried to the rear. plasma is given on the way. hospital dugouts are ready for anything. and we are ready to advance again. [whistle] we call for artillery. [explosions] an artillery duel develops at night. [explosions] one of our ammunition dumps...
74
74
Feb 15, 2020
02/20
by
CSPAN2
tv
eye 74
favorite 0
quote 0
who ought to think of themselves like insid ers shaped by institution they are in instead of function ing as outsiders instead of building personal brand. this is obviously in politics. any doubt that donald trump sees the presidency as a stage for performative outrage rather than executive acting through it. what exactly is he doing when he tweets displeasure of the department of justice, for example, the department of justice works for him f he had a sense, he would direct executive branch rather than complain about it. a president normally would, sense of his extraordinary is yet another stage for the reality television show that his life has been for so long. any question at the same time that many members of congress of both parties now run for office less to be involved in legislative work and more to have a prom prominent platform and become more visible to talk radio, use their elected office mostly as platform to complain about the very institution that they work so hard to enter. they sigh that as what their voters want. they are always performing to core partisan audience. two
who ought to think of themselves like insid ers shaped by institution they are in instead of function ing as outsiders instead of building personal brand. this is obviously in politics. any doubt that donald trump sees the presidency as a stage for performative outrage rather than executive acting through it. what exactly is he doing when he tweets displeasure of the department of justice, for example, the department of justice works for him f he had a sense, he would direct executive branch...
106
106
Feb 4, 2020
02/20
by
CSPAN3
tv
eye 106
favorite 0
quote 1
essentially, trefr inging the cost of managing payroll from the employer to the low wage worker. i just want to emphasize it's very broad and is used in many ways. it can refer to companies and technologies. we recognize that safe technology can benefit people but too often we see these companies claiming to be eliminating banking deserts and sorting and empowering communities. one example is how companies in new york are seeking to circumvent strong consumer protection laws including laws that have kept out payday and other exploitive lending from our state. the administration's efforts currently to exempt companies from critical consumer protection roles only exacerbate these serious risks. thank you for your time. i look forward to addressing the other topics during the q&a. >> thank you. >> chairman waters, since 1998 pay pal has been at the front of payments. it opens a technology digital payments plas form. through a combination of innovation and strategic partnerships. we offer people and businesses choice and flexibility. more ask more people are using smart phones to mak
essentially, trefr inging the cost of managing payroll from the employer to the low wage worker. i just want to emphasize it's very broad and is used in many ways. it can refer to companies and technologies. we recognize that safe technology can benefit people but too often we see these companies claiming to be eliminating banking deserts and sorting and empowering communities. one example is how companies in new york are seeking to circumvent strong consumer protection laws including laws that...
34
34
Feb 29, 2020
02/20
by
CSPAN
tv
eye 34
favorite 0
quote 0
true than this more through cyberspace where we see coordinated, ing long term campaigns of malicious harm the united states, our allies and partners, undermine international order. their objective is within -- is and in the ut war, end of conflict, to leverage heir access and capabilities prior to hostilities in order to achieve strategic advantage. russia, iran and north korea are using and will our sicyber -- adversary is also seeking to influence our citizens and to democratic institutions in order to achieve that strategic advantage that allow them to win for their national interests. intelligence community assesses that they are capable of and may seek to interfere in process.g the infrastructure that we use r to covertly influence our citizens in order to achieve an outcome. department of defense has now determined, at the president's direction that elections in end an enduring mission but we're art of a broader whole of government effort. an unprecedented level of oordination, and in that way the department of defense is playing a complementary and role to our domestic partner
true than this more through cyberspace where we see coordinated, ing long term campaigns of malicious harm the united states, our allies and partners, undermine international order. their objective is within -- is and in the ut war, end of conflict, to leverage heir access and capabilities prior to hostilities in order to achieve strategic advantage. russia, iran and north korea are using and will our sicyber -- adversary is also seeking to influence our citizens and to democratic institutions...
67
67
Feb 11, 2020
02/20
by
KRON
tv
eye 67
favorite 0
quote 0
shields the extra presence will make her future rides a little more comfortable having any ing to grasp on to kandahar every to grab >>i say 10 ambassadors worked previously in the bart system and have since been further s trained on de escalation and anti bias ctics i think the fact that will be riding the trains it be more visible haven't high visibity on a train. what ro in a kind of the escalating tuation is where we n't necessarily have to call the police and doeseducate in give people resources that we have i think that's the best way they will be able to impact the community now is is a 6 month pilot program meaning by august they will decide whether or not continue on with that bart says they will continue to speak with writers to get their feedback on how ese ambassadors are doing in oakland knoal bellokron 4 news. >>well coming up next on the kron 4 morning newsa san francischome featured in the self again how much is on the market for this time. >>a little peek ouide before we go just talking about how ni it feels outside you're already in the upper 50's and low 60's around t
shields the extra presence will make her future rides a little more comfortable having any ing to grasp on to kandahar every to grab >>i say 10 ambassadors worked previously in the bart system and have since been further s trained on de escalation and anti bias ctics i think the fact that will be riding the trains it be more visible haven't high visibity on a train. what ro in a kind of the escalating tuation is where we n't necessarily have to call the police and doeseducate in give...
41
41
Feb 24, 2020
02/20
by
KRON
tv
eye 41
favorite 0
quote 0
common sense plans tbeat trump,ixhe chaos in washington, common sense plans tbeat and get ings done.e: i'm mike bloombe and i approve this message. ♪ menutaur check out my triple bonus jack! check it out with an extra patt yeah! les ri! oh hey man, uhh... [car beeps] my $4.99 triple bonus jack combo! stack it up for an extra buck. >>welcome back now take a look at this video t of san francisco you see tht one of our producers came across a helicopter of us flying very cl like what we know that ews have been filming the next itallment of the matrix franise right here in san francisco 10 so exciting to watch right. but there's also been speculation that they could also shooting for the venom sequel so kind of feels very uthern calirnia la hollywood ish right here in san francio. so this is sir for folks you know walking around on city streets, you have a chanceto see. >>how they you know make them will be some which its i think we probably have right this is a helicopter for both movies that don't know which one this is what i think you know they're ing separate school it's really cool
common sense plans tbeat trump,ixhe chaos in washington, common sense plans tbeat and get ings done.e: i'm mike bloombe and i approve this message. ♪ menutaur check out my triple bonus jack! check it out with an extra patt yeah! les ri! oh hey man, uhh... [car beeps] my $4.99 triple bonus jack combo! stack it up for an extra buck. >>welcome back now take a look at this video t of san francisco you see tht one of our producers came across a helicopter of us flying very cl like what we...
35
35
Feb 28, 2020
02/20
by
KRON
tv
eye 35
favorite 0
quote 0
still ing. always ening. i don't know where not that one! the g one. you can't sneak a good earning opportunity st me. inact... i've got a hand modeling g th starts right now. earn 1.5% cash bac on everything you buy th freedom unlited. oooh. my hand lookgood. chase. make more of what's yours. we choose to go to the and do the other things, not because they are easy, but because th are hard. president kennedy ew settling for half-measures wasn't good enough when candidates say we can't guarantee health ce for all, make college affordable for all, combat cmate change, create a world at peace, remember that erica is best when we strive to big things, even when 's hard. bernie sandersnd i approve this message.
still ing. always ening. i don't know where not that one! the g one. you can't sneak a good earning opportunity st me. inact... i've got a hand modeling g th starts right now. earn 1.5% cash bac on everything you buy th freedom unlited. oooh. my hand lookgood. chase. make more of what's yours. we choose to go to the and do the other things, not because they are easy, but because th are hard. president kennedy ew settling for half-measures wasn't good enough when candidates say we can't...
53
53
Feb 20, 2020
02/20
by
BBCNEWS
tv
eye 53
favorite 0
quote 0
she had the surgery at the end of last month at ings couege the end of last month at ings college hospitalurgeons could hear her play the instrument so that they knew they were avoiding the area of the brain are used in playing the violin. now, if you've ever wondered what a million—dollar bottle of whisky looks like — take a look at this. it's an extremely rare macallan, bottled in 1926. it's just broken all records, when it was sold to an unknown european buyer during an online auction in scotland. the bottle was part of an extensive collection amassed by a whisky connoisseur from colorado in the united states. the total price was $1,072,000. and you can get in touch with me and most of the team on twitter — i'm @bbcmikeembley. hello there. we have a number of severe flood warnings still in force across parts of the country and particularly in england and we have more rain in the forecast, which is going to exacerbate this issue. the met office has yellow warnings for rain in parts of wales, north—west england and south—west scotland. these areas seeing quite a lot of rain by the time we
she had the surgery at the end of last month at ings couege the end of last month at ings college hospitalurgeons could hear her play the instrument so that they knew they were avoiding the area of the brain are used in playing the violin. now, if you've ever wondered what a million—dollar bottle of whisky looks like — take a look at this. it's an extremely rare macallan, bottled in 1926. it's just broken all records, when it was sold to an unknown european buyer during an online auction in...
39
39
Feb 17, 2020
02/20
by
KRON
tv
eye 39
favorite 0
quote 0
>>well the man's name is not ing released and detectives are still looking for more witnesses. well to the east bay now brit with police there are investigating a crash that killed a man ke a look at this picture. this is a picture of the crash that happened along fairview avenue between central and san jose avenue you see that car almost wrapped around a tree, the driver was trapped inside and died. and police don't think that alcohol was involved the driver's identity has not yet been released.well over to the peninsula now in san bruno a man was arrested for dring under the influence and selling drugs. brian hernandez rodriguez was pulled over along el camino real in mibrae officials determined that he was under the influence of drugs at the time. during a vehicle search officers found meth marijuana xanax oxycodone and also other items that led them to believe that rodriguez was indeed selling drugs an undisclosed amount of cash was also seized. rodriguez has been booked into jail and faces several charges. well to the south bay, a man has been arrested in connection to 2 a
>>well the man's name is not ing released and detectives are still looking for more witnesses. well to the east bay now brit with police there are investigating a crash that killed a man ke a look at this picture. this is a picture of the crash that happened along fairview avenue between central and san jose avenue you see that car almost wrapped around a tree, the driver was trapped inside and died. and police don't think that alcohol was involved the driver's identity has not yet been...
40
40
Feb 4, 2020
02/20
by
CSPAN
tv
eye 40
favorite 0
quote 0
we judge campaign officials aide tonight and he was emphasizing how much buttigieg has spent cities,ing, not in big but mostly in the counties that went for barack obama in 2008 and 2012. that is where i saw buttigieg when i was there over the weekend. he has been to parts of iowa where you saw the obama to trump shift. the is campaigning there relentlessly. it will help him out with the final results and give him some good numbers. it may happen. we will find out a little later today. one of the fun things, guess what, cory booker is no longer a candidate, but the senator from new jersey won a delegate tonight. drake university, supporters for biden and two other campaigns, forgot who it was, they were not viable and they decided to put their support behind broker, so he won a delegate which i guess means he can go to the next debate. host: mayor michael bloomberg is waiting in the wings spending money, a campaign staff of over 1000 putting it into those big .6 states for super tuesday guest: this has never happened before, right, a candidate with that much money sitting out of the ear
we judge campaign officials aide tonight and he was emphasizing how much buttigieg has spent cities,ing, not in big but mostly in the counties that went for barack obama in 2008 and 2012. that is where i saw buttigieg when i was there over the weekend. he has been to parts of iowa where you saw the obama to trump shift. the is campaigning there relentlessly. it will help him out with the final results and give him some good numbers. it may happen. we will find out a little later today. one of...
45
45
Feb 21, 2020
02/20
by
BLOOMBERG
tv
eye 45
favorite 0
quote 0
--ing up john paul misty mustier has said -- is said to have emerged as the contender for the top jobt hsbc. that's next. this is bloomberg. ♪ nejra: this is "bloomberg daybreak: europe." the ceo of unicredit jean pierre mustier has emerged as one of the contenders for the top job at hsbc. joining us to discuss from rome is our european finance editor. what credentials does he have that makes him suitable for this top job? all, he is a slasher. his record at unicredit has been a lot of rationalization and jobs to be saved. doing,ch what they are so that is very parallel. he does have some asian experience and worked as an investment banker in asia earlier in his career. it is more the experience in rationalizing making the bank more efficient and doing cutting. nejra: we heard that in the latest earnings. cost cutting and suspending the share buyback meant the shares took a hit. what does this mean for noel quinn, ross? >> still in limbo. you have to wonder how long his patience is. i think investors might find that a bit confusing. he still has not nailed down the top job and still h
--ing up john paul misty mustier has said -- is said to have emerged as the contender for the top jobt hsbc. that's next. this is bloomberg. ♪ nejra: this is "bloomberg daybreak: europe." the ceo of unicredit jean pierre mustier has emerged as one of the contenders for the top job at hsbc. joining us to discuss from rome is our european finance editor. what credentials does he have that makes him suitable for this top job? all, he is a slasher. his record at unicredit has been a lot...
32
32
Feb 6, 2020
02/20
by
CSPAN2
tv
eye 32
favorite 0
quote 0
the presiding officer: without ing officer: the senator from utah. mr. romney: thank you, mr. president. the constitution is at the foundation of our republic success and we each strive not to lose sight of our promise to defend it. the constitution established the vehicle of impeachment that is occupied both houses of our congress these many days. we have labored to faithfully execute our responsibilities to it. we have arrived at different judgments, but i hope we respect each other's good faith. the allegations made in the articles of impeachment are very serious. as a senator juror, i swore an oath before god to exercise impartial justice. i am profoundly religious. my faith is at the heart of who i am. i take an oath before god as enormously consequential. i knew from the outset that being tasked with judging the president, the leader of my own party, would be the most difficult decision i have ever faced. i was not wrong. the house managers presented evidence supporting their case and the white house counsel disputed that case. in addition, the president's team presented
the presiding officer: without ing officer: the senator from utah. mr. romney: thank you, mr. president. the constitution is at the foundation of our republic success and we each strive not to lose sight of our promise to defend it. the constitution established the vehicle of impeachment that is occupied both houses of our congress these many days. we have labored to faithfully execute our responsibilities to it. we have arrived at different judgments, but i hope we respect each other's good...
64
64
Feb 16, 2020
02/20
by
CSPAN3
tv
eye 64
favorite 0
quote 0
through the intervening years --ing where harry truman independence missouri has continued to be homeo him. it is now called the summer white house. harry s ferment is fundamentally -- harry s truman is fundamentally an average american. not rich, but not poor. a hard worker and very much a family man. areas in the backyard lawn of his summer white house of independence. the family is equally unpretentious and american. to the president the first lady of the land is known as sarah. they are bound by a fighting devotion. mary margaret is their only child. her mother well past 90 years of age, to whom he is extremely devoted. the family farm where harry spent his boyhood, she taught him to be fair and honest. both things the president has never forgotten. in spite of the heavy weight of her many years, she is surprisingly active. she still never loses an opportunity of giving mother's advice. the president has never lost interest in the family farm land which he still retains. the president's mother says, harry could plow greater than any other boy in the county. harry was a farmer when
through the intervening years --ing where harry truman independence missouri has continued to be homeo him. it is now called the summer white house. harry s ferment is fundamentally -- harry s truman is fundamentally an average american. not rich, but not poor. a hard worker and very much a family man. areas in the backyard lawn of his summer white house of independence. the family is equally unpretentious and american. to the president the first lady of the land is known as sarah. they are...
26
26
Feb 28, 2020
02/20
by
KRON
tv
eye 26
favorite 0
quote 0
twith your goo ragtag group of misfits,ing somehow wins it all, mov. twitremember guys,tag gglory sts forever.g bottle that confidence, mi. tomorrow you triumph >>an 11 ar-old boy was struck n a hit killed a car in antioch he was crossing the street with his brother, here'svideo of the car that hitim. this white vehicle wi front end damage. the boy was walking with s brother noin the crosswalk at launch the brother survived the road. driver stopped and cooperated with the police and the driver was not impaired they say nor was the driver arrested. >>san francisco is movg closerto opening a medically supervised space where addicts can safely inject drs. mayor london breed and supervisor matt haney are introducing new legislation to pavthe way for sa injection sites. the plan will tablish a ocess for norofits to apply for permits from the department publ health to open upthe safe injection sites. the mayor is hoping this program will save lives and encourage addicts to get clean. >>that's whatthis is about when they are ready when the say the word there
twith your goo ragtag group of misfits,ing somehow wins it all, mov. twitremember guys,tag gglory sts forever.g bottle that confidence, mi. tomorrow you triumph >>an 11 ar-old boy was struck n a hit killed a car in antioch he was crossing the street with his brother, here'svideo of the car that hitim. this white vehicle wi front end damage. the boy was walking with s brother noin the crosswalk at launch the brother survived the road. driver stopped and cooperated with the police and the...
115
115
Feb 28, 2020
02/20
by
CSPAN
tv
eye 115
favorite 0
quote 1
[cheers and applause] senator sanders: i'm asking you and ing out your friends your co-workers and yourhbors so we can have the largest voter turnout in the istory of the south carolina primary. [cheers and applause] senator sanders: and if your riends don't want to come out and vote, tell them you're tired their complaining. you're tired of hearing them about low wages, igh cost of rent, or the fact that they are $50,000 in debt, hearing about the fact that the government is doing too climate change, tired of hearing them talk about all he racism and the sexism, the homophobia. that -- we are not in the mood for complaining. we are now in the mood for action. cheers [cheers and applause] senator sanders: and that's what we are about. we are not just a campaign. movement! [cheers and applause] senator sanders: trump wants to divide us up. bringing people together. lack and white and latino, native american, asian american. gay and straight. e are sick and tired of an economy and government that orks for wealthy campaign contributors. we're tired of three people the g more wealth than bo
[cheers and applause] senator sanders: i'm asking you and ing out your friends your co-workers and yourhbors so we can have the largest voter turnout in the istory of the south carolina primary. [cheers and applause] senator sanders: and if your riends don't want to come out and vote, tell them you're tired their complaining. you're tired of hearing them about low wages, igh cost of rent, or the fact that they are $50,000 in debt, hearing about the fact that the government is doing too climate...
81
81
Feb 28, 2020
02/20
by
FBC
tv
eye 81
favorite 0
quote 0
monday, 1,031 points, tuesday 879 points cut, wednesday people thought well maybe we're bottom ing out only a loss of 123 , yesterday the largest point drop in history for the dow, a loss of 1,190. now we've got as i said, fed chair jerome powell promising to appropriately use tools to support the economy but will monetary easing help stem the publics fear of going out i'd? i don't think if the borrowing becomes cheaper and getting loans becomes cheaper does that make any difference whether you go into a crowded theatre? how would a fed rate cut help the overall economy if the coronavirus crisis worsens? bring in our traders right now, john gagliardi, give me your thoughts? >> i've been talking to clients and i have clients sitting in cash for years, and they've all been saying the same thing, if there was just a pullback, if we could just get a pullback i could get interested in markets again and here we are. this is it so i have to ask all my clients, what's your number? what's the number that gets you in? is it 2,900 which we saw today? is it 28, 27, at what point do you say the mar
monday, 1,031 points, tuesday 879 points cut, wednesday people thought well maybe we're bottom ing out only a loss of 123 , yesterday the largest point drop in history for the dow, a loss of 1,190. now we've got as i said, fed chair jerome powell promising to appropriately use tools to support the economy but will monetary easing help stem the publics fear of going out i'd? i don't think if the borrowing becomes cheaper and getting loans becomes cheaper does that make any difference whether you...
51
51
Feb 28, 2020
02/20
by
BLOOMBERG
tv
eye 51
favorite 0
quote 0
i think we will see the fed act ing. this is a very dovish federal reserve. tom: come they get there, can they get out three weeks? carsten: at the moment, i would say yes. i think we have still seen a dramatic tightening of financial conditions. but i think we have not seen the tightening in credit markets that they are particularly sensitive to. i suspect we will see action on on balance at the moment, i expect that to be the normal timetable. federal banks will act. governments will act. we are seeing from asia, fiscal packages coming out. we have a package in the u.k. in the next few weeks. i am certain will see fiscal action in the u.k. in response to the violence. the issue is that -- response to the virus. the issue is that permits will be limited in what they can do. to.ng demonstrate that you have a grip at the same time, if you look at the playbook that em governments have, there is a lot of public information on how governments will respond to a widespread pandemic. we will not see in most em countries attempts to close down activity. we may see so
i think we will see the fed act ing. this is a very dovish federal reserve. tom: come they get there, can they get out three weeks? carsten: at the moment, i would say yes. i think we have still seen a dramatic tightening of financial conditions. but i think we have not seen the tightening in credit markets that they are particularly sensitive to. i suspect we will see action on on balance at the moment, i expect that to be the normal timetable. federal banks will act. governments will act. we...
18
18
Feb 7, 2020
02/20
by
CSPAN
tv
eye 18
favorite 0
quote 0
solemnly swear that in pertained to ing the impeachment of donald john will do w pending, you im -- impartial justice as far as -- >> senate will convene of the of impeachment. >> we've seen a dissent into constitutional matters. basis n, we think the upon which this has moved forward is irregular, to say the least. john trump, president of the united states, is not second s charged in the article of impeachment. >> for the third time in u.s. istory, a president has been impeached and acquitted. from the house hearings to the has e trial, c-span provided live comprehensive overage of the impeachment of president trump. you can find all of our video and related resources at c-span.org/impeachment. c-span, your place for unfiltered coverage of congress. >> monday, president trump holds a campaign rally in manchester, 7:00 p.m. re, at eastern. watch our campaign 2020 coverage c-span3, c-span.org, or listen with the free c-span radio app. ntinues. >> -- member ofey davis, a the administration committee, the ranking members to talk about election security. good morning. how much more prepared are
solemnly swear that in pertained to ing the impeachment of donald john will do w pending, you im -- impartial justice as far as -- >> senate will convene of the of impeachment. >> we've seen a dissent into constitutional matters. basis n, we think the upon which this has moved forward is irregular, to say the least. john trump, president of the united states, is not second s charged in the article of impeachment. >> for the third time in u.s. istory, a president has been...